Revista MVZ Córdoba

La diarrea viral bovina (DVB) representa un problema de ámbito mundial que causa considerables pérdidas tanto en ganado de carne como lechero, afectándolo de diversas formas las cuales están supeditadas a la edad del animal, estado inmunológico y momento de la gestación en el que se produce la infección. La DVB es causada por un virus ARN, género Pestivirus, familia Flaviviridae, el cual ha sido clasificado en 2 biotipos (citopático y no citopático) según su comportamiento en células de cultivo y en 2 genotipos (I y II) basados en su secuencia genética. Dependiendo de las cepas infectantes se presenta un cuadro clínico particular variando en severidad desde una forma subclínica, pasando por la forma clínica e incluso produciendo la fatal enfermedad de las mucosas o causando efectos deletéreos sobre el feto. A pesar de que en nuestro medio ya existen estudios sobre esta entidad, la implementación de metodologías diagnósticas constituye una limitante para el manejo de la misma. La presente revisión se enfoca en la patogenia e inmunopatología de la DVB.

Bovine viral diarrhea (BVD) represents a problem of worldwide causing considerable losses so much in meat livestock as in dairy herds, affecting it in diverse ways, which are subordinated to the age of the animal, immunologic state and moment of gestation, in which the infection takes place. BVD is caused by RNA virus, gender Pestivirus, family Flaviviridae, which has been classified in 2 biotypes (cytopathic and non cytopathic) according to its behavior in cultivation cells and in 2 genotypes (I and II) based on its genetic sequence. Depending on the infectious strains a square clinical matter is presented, varying in severity from a subclinic form, going by the clinical form and even producing the fatal disease of the mucous ones (MD) or causing deleterious effects on the fetus. Although studies already exist in our environment on this entity, the implementation of diagnostic methodologies constitutes an obstacle for the handling of the same one. This review is focused on pathogenyty and inmunopathology of the BVD.

Objetivo. Realizar un cultivo experimental de cladócero Moina sp alimentado con Ankistrodesmus sp y Saccharomyces cereviseae. Materiales y métodos. Fueron realizados cultivos experimentales de la cepa de cladóceros Moina sp en el laboratorio de Alimento Vivo de la Universidad de Córdoba, bajo condiciones controladas de temperatura (22°C), pH (7.6), intensidad lumínica (2000 lux) y aireación. Se emplearon dos dietas de alimento como tratamiento (Ankistrodesmus y Ankistrodesmus mas Saccharomyces cereviseae) en concentración de 40 x 105 cel.ml-1 cada uno, para determinar su efecto sobre el desempeño de la población. Diariamente se registró la densidad poblacional y celular. Resultados. Se obtuvieron diferencias significativas para el efecto de las dietas sobre el crecimiento poblacional de los cladóceros, los individuos alimentados con Ankistrodesmus sp + Saccharomyces cereviseae alcanzaron una densidad de 12.3ª ±0.30 org/ml-1 presentando mayor tasa instantánea de crecimiento (K) 0.36 ± 0.002, el menor tiempo de duplicación (td) 1.94 ± 0.012 y el mayor rendimiento (r) 1,1 ± 0.07 clad.ml-1.día-1. Conclusión. Los cladóceros por sus características de crecimiento en cultivo, presentan adaptación favorable a las condiciones de manejo para la producción de biomasas potencialmente útiles como partícula nutritiva con fines acuícolas.

Objetive. Realize an experimental cuculture of cladorerans Moina sp feed with Ankistrodesmus sp and Saccharomyces cereviseae. Materials and methods. At Universidad de Córdoba, Laboratory of Food Live, experimental cultivations of the cladocerans stump Moina sp under controlled conditions of temperature (22°C), pH (7.6), light intensity (2000 lux) and air condition were made. Two food diets were used as treatments (Ankistrodesmus and Ankistrodesmus + Saccharomyces. cereviseae) in concentration of 40 x 105 cel.ml-1, to determine their effect on the population’s acting. Populational and celular density were registered dail y. Results. The results showed significant difference for the effect of the diets on the populational growth of the cladocerans, the individuals fed with Ankistrodesmus sp + Saccharomyces cereviseae reaches density of 12.3ª ±0.30 org/ml-1 presenting highest instantaneous rate of growth (K) 0.36 ± 0.002, the smallest time of duplication (td) 1.94 ± 0.012 and the highest yield (r) 1,1 ± 0.07 clad.ml-1.day-1. Conclusions. These cladocerans for their characteristics of growth in cultivation, present favorable adaptation to the handling conditions to produce biomasses potentially useful as nutritious particle with aquaculture purposes.

Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.

Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales y métodos. Se utilizó un procedimiento de extracción con el agente caotropico NaI, para reducir la grasa en la muestra a un 0.2% p/v, el cual es mas bajo limite de detección con el método de Gerber para evitar la polimerización. Las muestras de leche cruda fueron analizadas por el método estandar de oro para la detección de L. monocytogenes. La detección por PCR fue realizada amplificando el segmento específico de 938bp de 16S ADNr. Los siguientes cebadores fueron utilizados L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) que reconoce el gen hlyA de L. monocytogenes y que amplifica un fragmento de 750bp. Resultados. El ADN de 39 cepas evidenció una alta especificidad de la técnica ya que todas las 39 L. monocytogenes amplificaron los fragmentos de 938bp y 750bp especie especifica. El límite de detección de la PCR fue de 101 CFU/ml. La reproducibilidad de la PCR mostró un Kappa de 0.85, la especificidad y sensibilidad fueron del 100%. El valor predictivo positivo y negativo fue del 100%. Conclusiones. Los resultados demostraron que es posible detectar Listeria spp usando cualquiera de los tres métodos ya que poseen la misma sensibilidad y especificidad. El 100% del valor predictivo positivo provee una alta posibilidad de detección en muestras positivas con listeria. EL método de extracción y la PCR estandarizada permiten en 15 días detectar L. monocytogenes en leches crudas. La técnica de PCR puede ser adaptada y validada otros tipos de alimentos como pollos, carnes y quesos.

Objetivo. Determinar la calidad de la leche cruda en dos sistemas de producción, en diferentes regiones de Colombia. Materiales y métodos. Se realizó un análisis retrospectivo de las bases de datos de ocho empresas procesadoras de leche, que incluyeron parámetros físicos, químicos y bacteriológicos de leches crudas en 1.159 fincas ubicadas en sistemas de producción de leche especializada y de doble propósito. Resultados. En el sistema doble propósito, se encontraron los mayores niveles de proteína, grasa, sólidos no grasos y sólidos totales. Conclusiones. Se observaron valores muy extremos en una misma región, para las diferentes variables estudiadas; lo que permite establecer que hay fincas de una misma región que presentan buenas y malas prácticas de manejo. Así mismo se hace necesario elevar los niveles de los diferentes componentes químicos de la leche particularmente en el sistema especializado y de mejorar la calidad bacteriológica; todo esto se logra mediante la implementación de un programa de buenas prácticas ganaderas.

Objective. To determine milks raw quality on two production systems in different regions of Colombia. Materials and methods. A retrospective database analysis was carried out of eight milk processing plants to determine the milk quality in different production systems. This analysis included physical, chemical and bacteriological parameters of raw milk in 1.159 farms located in specialized dairy and of double purpose systems of production. Results. The system of double purpose is located in the low tropic (<1.2000 m.s.n.m), in this system the biggest protein levels, fat, non fatty solids and total solids were found; likewise very extreme values were observed in the same region for the different studied variables. Conclusions. It was observed extremely values in the same region. This allowed to establish farms with variable of good practices of production. Likewise it becomes also necessary to elevate the levels of the different chemical components of the milk, particularly in the specialized system and to improve the bacteriological quality; all this can be achieved by means of the implementation of a good cattle program practices.

Objetivo. Estudiar los factores ambientales y genéticos que influyen sobre la edad al primer parto de hembras romosinuano. Materiales y métodos. Fueron estudiados 932 datos de la edad al primer parto de hembras de la raza romosinuano, nacidas en el Centro de Investigación Turipaná de CORPOICA, Cereté, Colombia, en el período de 1980 a 2001. Para el estudio de los factores ambientales se utilizó el análisis de varianza mediante modelos lineales utilizando el procedimiento GLM de SAS (1995). Resultados. La edad al primer parto fue de 1162.3±4.2 días, con un coeficiente de variación del 11.19%. El análisis de varianza reveló que el año y mes de nacimiento fueron causas estadísticamente significativas de variación de la edad al primer parto. La heredabilidad, calculada por la correlación intraclase entre medias hermanas paternas fue de 0.16±0.08. Conclusión. El año y mes de nacimiento influyeron en la edad al primer parto de hembras romosinuano, pero la heredabilidad de la edad al primer parto y el sexo de la cría no se constituyen en características importantes a tener en cuenta.

Objetive. To study the enviromentals and genetics factors that influence on the age and the first delivery of romosinuano females bovines. Materials and methods. From the age to the first calving of native cattle of Colombia romosinuano, 932 data were studied from a herd at the Turipaná Experimental Station of CORPOICA, Cereté, Colombia, between 1980 to 2001. For the study of the environmental factors the variance analysis was used by means of lineal models using the GLM of SAS procedure (1995). Results. The age to the first calving was of 1162.3±4.2 days, with a coefficient of variation of 11.19%. The variance analysis revealed that the year and month from calving were statistically significant causes of variation of the age to the first calving. The heritability, calculated by the correlation intra-class between half-sibs was of 0.16±0.08. Conclusions. Year and month of birth influenced over the age in the first delivery of romosinuano cows. However, age heredability at first calve and the calf sex it appears to be no important.

Objetivo. Establecer la relación entre la pubertad y la circunferencia escrotal en toros de las razas holstein, Cebu y romosinuano. Materiales y métodos. Se tomaron 8 machos F1 Holstein x Cebú (HxC), 8 Cebúes y 10 Romosinuanos, a partir del destete. En los grupos HxC y Cebú, durante la fase de experimentación se realizó evaluación de medidas testiculares (circunferencia escrotal, longitud individual), peso corporal con ayuno de 12 horas, perímetro toráxico y alzada a la cruz. Desde el destete hasta los 12 meses de edad las medidas se realizaron cada 28 días. Posterior a los doce meses las evaluaciones se llevaron a cabo cada 15 días y en cada evaluación se realizó colecta de semen mediante electroeyaculador. Resultados. Se presentaron diferencias estadísticas para la edad a la pubertad entre el Cebú y los grupos raciales HxC y Romosinuano (p<0.0003); siendo la raza Romosinuano la de menor edad a la pubertad, igualmente, se confirmo el efecto de la heterosis sobre la edad a la pubertad con el grupo racial HxC siendo el de menor edad a la pubertad. Para el peso a la pubertad se presentaron diferencias estadísticas significativas para los tres grupos raciales (p<0.0001), siendo los toros Cebú los más pesados y los Romos los de menor de peso. Asimismo para la CE se presentan diferencias entre el Romosinuano y los grupos raciales HxC y Cebú (p<0.0045) a la pubertad, siendo la raza Cebú la que presenta los mayores valores. En los grupos raciales HxC, Cebú y Romosinuano, tanto en pre y pospubertad, las correlaciones entre CE con edad, peso, longitud testicular, perímetro toráxico, alzada a la cruz, y alzada al anca para Romosinuano son altas (r>0.8). Conclusión. Teniendo presente los resultados obtenidos se concluyó que la raza criolla romosinuano presentó menor edad a la pubertad que el Cebú y se confirmó además, el efecto de la heterosis sobre la edad a la pubertad con el grupo racial HxC, el cual tuvo una menor edad a la pubertad.

Objetive. To establish the relationship of puberty and scrotal circunference in holstein x Zebú, Zebu and romosinuano bullls. Materials and methods. Eight male F1 Holstein x Zebu (HxC), 8 Zebu and 10 Romosinuano starting from weaning were taken. In the group HxC and Zebu during the experimentation phase, evaluation of testis size (scrotal circumference, individual longitude), corporal weight with fast of 12 hours, thoracic perimeter and cross height were made. From weaning to the 12 months of age the taking of measures was carried out each 28 days. Starting from the twelve months, sampling was made each 15 days and in each evaluation taking of semen was performed by means of an electroejaculator. Results. Statistical differences for the age to the puberty between the Zebu and the racial groups HxC and Romosinuano (p <0.0003) were presentd; being the Romosinuano race was the one from smaller age to the puberty. Futhermore, the effect of the heterosis on the age to the puberty with the racial group HxC was confirmed being the one from smaller age to the puberty. Relationship between weight and puberty were significant statistical for the three racial groups (p <0.0001), being the Zebu bulls the heaviest and the Romos ones those of lesser weight. Likewise, for the CE differences were presented between the Romosinuano and the racial groups HxC and Zebu (p <0.0045) to the puberty, being the Zebu race the one that presented the biggest values. In the racial groups HxC, Zebu and Romosinuano, so much in pre and post-puberty, the correlations among CE with age, weight, testis longitude, thoracic perimeter, cross height and croup height for Romosinuano are high (r>0.8). Conclusions. Creole Bos taurus romosinuano showed puberty at minor age than Zebu. Effect of heterosis was confirmed over the age to puberty with the ratial group HxC.

Objetivo. Evaluar la influencia de la condición corporal (CC) preparto y producción de leche (PL), hasta el primer estro y/o los 65 días después del parto, sobre la variación del peso en el período parto - 70 días (VP70D) después del parto, la condición corporal (CC) al primer estro observado (EO) y la diferencia de CC del parto al primer EO. Materiales y métodos. Fueron utilizadas 36 vacas mestizas Holstein por Cebú (HxC), en un diseño experimental completamente al azar, con arreglo factorial 3x2, con tres categorías de CC y dos niveles de PL. Resultados. La CC al parto influyó (P£0.01) en la variación del peso del parto al día 70 después del parto. La PL no influyó (P>0.05) en la variación del peso en el período parto 70 días después del parto. La CC de las vacas al parto influyó en el CC al estro (P£0.05), donde las vacas de CC baja al parto ganaron CC y las de CC media y alta perdieron, aunque la CC fue mayor en las vacas con mejor CC al parto. La PL no influyó en la CC al estro (P>0.05). La CC al parto influyó en la diferencia de CC al parto - primer estro (P£0.01), ya que las vacas de CC baja al parto ganaron 0.44 unidades y las de CC media y alta perdieron 0.05 y 0.37, respectivamente. La PL no afectó (P>0.05) la diferencia de CC en el período parto - primer estro. Conclusión. Las vacas con CC alta perdieron peso por un periodo más largo que las vacas con CC media y baja, con efectos menores en ambos casos sobre la producción láctea. El primer estro posparto no estuvo influenciado por la CC preparto ni por la producción de láctea.

Objetive. To evaluate the influence of body condition (BC) to calving and of milk production (MP), until the first estrus and/or the 65 days after calving on the variation of weight in calving period - 70 days (VW70D) after calving, body condition (BC) to the first observed estrus (OE) and the difference of (BC) of calving to the first OE. Materials and methods. 36 crossbred cows were used Holstein by Zebu (HxC), in an experimental design totally at random, in factorial arrangement 3x2, with three categories of BC and two levels of MP. Results.The BC to calving influenced (P 0.01) in the weight variation of calving to day 70 after calving. The MP did not influence ((P>0.05) in the weight variation in calving period 70 days after calving. BC of cows to calving influenced in the BC to estrus (P 0.05), where the cows of low BC to calving won BC and those of BC half and high lost, although the BC was higher in the cows with better BC to calving. The MP did not influence in the BC to estrus (P>0.05). The BC to calving influenced in the difference of BC calving- first estrus (P 0.01), since the cows of low BC to calving won 0.44 units and those of half and high BC lost 0.05 and 0.37, respectively. MP didn’t affect (P>0.05) the difference of BCS in calving period - first estrus. Conclusion. The cows with hight body condition score (BCS) lost weight for a longer period than cows with medium and low BCS, with minor effects in both cases for milk production. The first postpartum estrus was not influenced by the pre-delivery BCS nor by the milk production.

Objetivo. Seleccionar un modelo matemático para la curva de lactancia de la producción de leche de hembras vacunas. Materiales y métodos. Durante 11 meses, se estudió la producción de leche en 500 novillas doble propósito Bos taurus x Bos indicus, de las sabanas del trópico bajo colombiano. La producción se cuantificó en kilogramos. Se incluyeron los datos de la producción de leche en época (seca-lluviosa) y número de lactancias (primera; segunda y tercera y, más de tres). Los datos hacen parte del archivo de la Ganadería XB, ubicada en las sabanas de Bolívar, Colombia, recopilados desde el año 1990 hasta el 2000. A estos datos se le aplicó los modelos lineal simple, cuadrático, lineal logarítmico, cuadrático logarítmico, gamma incompleto, lineal hiperbólico y polinomial inverso. Los parámetros para los modelos gamma incompleto y polinomial inverso fueron estimados, a partir del método de "Gauss-Newton", para la regresión no lineal; los demás modelos fueron ajustados por regresión lineal de las producciones, en función de los meses en lactancia, por el método de los cuadrados mínimos. Resultados. En los modelos propuestos, se observó que el modelo polinomial inverso es el que mejor caracteriza la curva de lactancia por presentar los mayores valores para el estadístico Durbin-Watson y coeficiente de determinación (R²) y sobre dicho modelo existe información necesaria para obtener parámetros prácticos calculados a partir de la ecuación de la curva de lactancia. Conclusión. El modelo matemático polinomial inverso se constituye en una excelente herramienta para aplicar en la administración y toma de decisiones en el manejo de hatos del sistema de doble propósito.

Objective. To select a mathematical model for the lactation curve of milk production in bovine females. Materials and methods. During 11 months, the production of milk was studied in 500 bovine females double purpose Bos taurus x Bos indicus, at the Savannas of the Colombian Low Tropic. Production was quantified in kilograms. Data of milk production were included in time (dry-rainy) and number of lactations (first; second and third and, more than three). Data make part of the Cattle raising XB file, located in Bolivar’s Savanna, Colombia, gathered from the year 1990 up to the 20000. The lineal simple, quadratic, lineal logarithmic, quadratic logarithmic, incomplete gamma, lineal hyperbolic and inverse polynomial models were applied to these data. nursings (first; second and third and, more than three). The data make part of the file of the Cattle raising XB, located in Bolívar’s Savannas, Colombia, gathered from the year 1990 up to the 2000. The parameters for the incomplete gamma and inverse polynomial models were estimated starting from the "Gauss-Newton" method to non lineal regression; the other ones were adjusted by lineal regression of the productions in function of the months in lactation by the minimum squares method. Results. It was observed that the inverse polynomial model is the one that better characterizes the lactation curve, presenting the biggest values for the Durbin-Watson statistic and the coefficient of determination (R²) and about this model necessary information exists to obtain practical parameters from the lactation curve equation. Conclusion. The mathematical polynomial model inverse is an excellent tool to approach the administration and desicions management of cattle double purpose.

Objetivo. Establecer la frecuencia del celo, la tasa de fertilidad y los niveles de progesterona (P4) en vacas brahman. Materiales y métodos. Se analizaron la presentación del celo, la tasa de fertilidad y los niveles de P4 al momento de la IA en vacas Brahman (n=160) en una Finca del departamento de Cundinamarca (Colombia). Resultados. La mayor frecuencia de celos se observó en la mañana (68.75%) respecto a la tarde (31.25%). Los valores promedio de P4 fueron de 0.22ng/ml, con valores máximos y mínimos de 3.035ng/ml. y 0.000ng/ml, respectivamente. La eficiencia en la detección del celo por niveles de P4 fue alta (96. 25%). El promedio de tiempo transcurrido entre el momento de la detección de la vaca en celo y la inseminación fue de (12.6 horas). No se encontró una asociación estadística entre los niveles de P4 al momento de la inseminación con la tasa de fertilidad (45%). Conclusiones. Las condiciones climáticas o la época pueden afectar la presentación del celo, que los niveles de P4 por si solos no explican las tasas de fertilidad, que la P4 es útil en el manejo del control reproductivo y que la IA diferente al esquema AM -PM podría mejorar las tasas de fertilidad de los programas de IA en el trópico húmedo colombiano.

Objetive. To establish oestrus frecuency, fertility rate and progesterone levels in cows brahman. Materials and methods. Onset of oestrus, pregnancy rate and the P4 levels were analyzed to the moment of AI in Brahman cows (n=160) in a farm of Cundinamarca department (Colombia). Results. The biggest frequency of oestrus was observed in the morning (68.75%) regarding the afternoon (31.25%). Average values of P4 were of 0.22 ng/ml, with values maxima and minima of 3.035 ng/ml. and 0.000 ng/ml, respectively. The efficiency in the oestrus detection for levels of P4 was high (96.25%). The average of time lapsed among the moment of the oestrus detection and the insemination was of (12.6 hours). An statistical association did not found among the levels from P4 to the moment of the insemination with the fertility rate of (45%). Conclusions. The climatic conditions or the season can affect the onset of oestrus, that the levels of P4 by itself do not explain the rates of fertility, that the P4 is useful in the handling of reproductive control and that the AI different to the scheme AM - PM could improve the fertility rates of the programs of AI in the Colombian humid tropic.