SciELO - Scientific Electronic Library Online

 
vol.38 issue2Effect of vitamin E, potassium, and alcohol-fermented feed supplementation before transport on body weight, carcass characteristics, and meat color of Hanwoo steersCharacterization of bone marrow aspirate reports in dogs and cats: A retrospective study author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista Colombiana de Ciencias Pecuarias

Print version ISSN 0120-0690On-line version ISSN 2256-2958

Rev Colom Cienc Pecua vol.38 no.2 Medellín Apr./June 2025  Epub Nov 04, 2025

https://doi.org/10.17533/udea.rccp.38n3a5 

Original Research Article

Lethal infection by herpes simplex virus 1 (HSV-1) in a captive Azara's owl monkey (Aotus azarae) in Paraguay

Infección letal por virus herpes simplex 1 (HSV-1) en un mono Marikiná de Azara (Aotus azarae) cautivo en Paraguay

Infecção letal pelo vírus herpes simplex 1 (HSV-1) em um macaco Marikiná de Azara (Aotus azarae) em cativeiro no Paraguai

J. Richard Vetter1  2  * 
http://orcid.org/0000-0002-4665-2659

Marlene Florentín-Morel3 
http://orcid.org/0009-0008-9625-5572

María-Graciela Riera-Domínguez4 
http://orcid.org/0000-0002-4217-4960

Ricardo G. Cañiza1 
http://orcid.org/0009-0008-4592-5484

1Universidad Nacional de Asunción, Facultad de Ciencias Veterinarias, Departamento de Recursos Faunísticos y Medio Natural, Paraguay.

2Refugio Silvestre Urutaú, Paraguay.

3Clinica Veterinaria Diego Dacak, Paraguay.

4Departamento de Investigación y Docencia, Laboratorio Meyer Lab, Paraguay.


Abstract

Anamnesis:

A 2-year-old male Aotus azarae was brought to the wild animal clinic. The animal weighed 975 grams and was in poor body condition. The individual had been kept in close contact with the caretakers and was largely fed by the people in the household, sharing their meals. According to the caretaker, the animal had been asthenic and anorexic for approximately two days.

Clinical and laboratory findings:

On clinical inspection, the animal was weakened, with pale oral mucosa, hyperemic pharynx, and a rectal temperature of 34.2°C. Dry crusts were observed in the perinasal region, and mild dyspnea was perceived. The patient died during the inspection. The hemogram was suggestive of normocytic normochromic anemia, leukopenia, hypoproteinemia, and thrombocytopenia. Molecular analysis detected HSV-1.

Conclusion:

Data obtained through anamnesis and clinical history, as well as hematologic findings and PCR results, confirmed the diagnosis of HSV-1 infection. To the best of the authors' knowledge, this is the first report of the disease in a non-human primate in Paraguay.

Keywords: anthropozoonosis; Aotus azarae; cross-transmission; Herpesvirus; Herpes simplex virus; HSV-1; New World primate; owl monkey; PCR; Platyrrhini

Resumen

Anamnesis:

Un mono macho Aotus azarae de 2 años fue ingresado al Consultorio de Animales Silvestres. El animal pesaba 975 gramos y presentaba una baja condición corporal. El individuo se había mantenido en estrecho contacto con los cuidadores y era alimentado en gran medida por las personas de la casa, compartiendo sus comidas. Según informó el cuidador, el animal llevaba aproximadamente dos días asténico y anoréxico.

Hallazgos clínicos y de laboratorio:

En la inspección clínica, el animal estaba débil, con mucosa oral pálida, faringe hiperémica y temperatura rectal de 34,2ºC. Se observaron costras secas en la región perinasal y se evidenció una ligera disnea. El paciente falleció durante la inspección. El hemograma fue sugestivo de anemia normocítica normocrómica, leucopenia, hipoproteinemia y trombocitopenia. El análisis molecular detectó la presencia de VHS-1.

Conclusión:

La información de anamnesis e historia clínica, así como los hallazgos hematológicos y los resultados de PCR, confirmaron el diagnóstico de infección por VHS-1. Según el conocimiento de los autores, este es el primer reporte de la enfermedad en un primate no humano en Paraguay.

Palabras clave: antropozoonosis; Aotus azarae; Herpesvirus; Herpes simplex virus; HSV-1; mono búho; PCR; Platirrino; primate del Nuevo Mundo; transmisión cruzada

Resumo

Anamnese:

Um Aotus azarae macho de 2 anos de idade foi trazido para a clínica de animais selvagens. O animal pesava 975 gramas e estava em condição corporal baixa. O indivíduo estava em contato próximo com os cuidadores e era alimentado principalmente pelas pessoas da casa, compartilhando suas refeições. De acordo com o cuidador, o animal apresentava astenia e anorexia havia aproximadamente dois dias.

Achados clínicos e laboratoriais:

Na inspeção clínica, o animal estava debilitado, com mucosa oral pálida, faringe hiperêmica e temperatura retal de 34,2ºC. Crostas secas foram observadas na região perinasal e notou-se uma leve dispneia. O paciente morreu durante a inspeção. O hemograma foi sugestivo de anemia normocítica normocrômica, leucopenia, hipoproteinemia e trombocitopenia. A análise molecular detectou a presença de HSV-1.

Conclusões:

Os dados obtidos na anamnese e na história clínica, bem como os achados hematológicos e os resultados da PCR, confirmaram o diagnóstico de infecção pelo HSV-1. Até onde se tem conhecimento, este é o primeiro relato da doença em um primata não humano no Paraguai.

Palavras-chave: antropozoonose; Aotus azarae; Herpesvírus; HSV-1; Macaco-coruja; PCR; Platirrino; Primata do Novo Mundo; transmissão cruzada; Vírus herpes simplex

Introduction

Herpesviruses are DNA-enveloped viruses with complex genomes that infect a wide variety of vertebrate species, with many primates and humans being natural hosts (Ludlage and Mansfield, 2003; Casagrande, 2014). Formerly classified within the family Herpesviridae, these viruses are now grouped into three families within the order Herpesvirales: the family Herpesviridae, which retains all mammalian, avian, and reptile herpesviruses; the new family Alloherpesviridae, comprising fish and frog viruses; and the new family Malacoherpesviridae, containing the viruses of bivalves. The family Herpesviridae is further divided into three subfamilies, among which are the 39 known species of human and non-human primate herpesviruses (Casagrande, 2014).

The genus Simplexvirus, within the subfamily Alphaherpesvirinae, contains five species of New World Primate herpesviruses (NWP), as well as two species of human herpesviruses: Herpes simplex virus 1 (HSV-1) and Herpes simplex virus 2 (HSV-2). Many human and non-human primates carry their own species of herpesviruses belonging to this genus, which normally do not cause clinical disease in immunocompetent natural hosts (Casagrande, 2014). Humans are the only primate species infected by two distinct Herpes simplex viruses: HSV-1 and HSV-2 (Wertheim et al., 2014). Herpesviruses have been infecting and coevolving with their vertebrate hosts for hundreds of millions of years (Wertheim et al., 2014). However, when these viruses infect different primate species, they can cause significant and often fatal clinical disease (Casagrande, 2014).

Unlike Old World Primates (OWP), which generally develop a self-limiting infection similar to that in humans, NWPs are more susceptible to HSV-1 infection, typically presenting a generalized and fatal disease characterized by anorexia, dermatitis, pruritus, depression, and ulcerative lesions in the oral cavity and gastrointestinal tract (Casagrande, 2014; Fortman et al., 2018). The disease caused by these viruses has been reported in captive NWPs of the genus Cebus (Zinsser, 1929; Souvignet, 2019), Aotus (Katzin, 1967; Barahona et al., 1976; Meignier et al., 1990; Gozalo et al., 2008; Kreutzer et al., 2011), Callithrix (Huemer et al., 2002; Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007; Sekulin et al., 2010; Imura et al., 2014; Araújo et al., 2016), and Pithecia (Schrenzel et al., 2003; Lapid and Eshar, 2017). Primates of the genus Aotus are known for their high susceptibility to HSV infection, in which the virus appears to have a predilection for the cerebral cortex, causing encephalitis (Calle and Joslin, 2015). For this reason, these primates are also used as a model for the study of the pathogen (Katzin et al., 1967; Todo et al., 2000; Roth et al., 2014).

Because of the frequent but unapparent spread of herpesviruses, careful handling of these animals should be recommended, and appropriate hygiene measures should be applied for the sake of both owners and pet monkeys. Standard veterinary practice considers whether diseases of primates that have been in close contact with humans may have been caused by human viruses (Huemer et al., 2002). In addition to considering the transmission of NWP herpesviruses, such as CeHV-1, to a human host, which can result in potentially fatal encephalitis (Casagrande, 2007), the potential link between a wild animal and an infection acquired from a human host should be highlighted, as humans in contact with the animal may not necessarily show signs of disease (Huemer et al., 2002). This occurs because herpesviruses typically do not cause severe infections in immunocompetent individuals of their natural host species, as most infections remain asymptomatic (Eberle and Jones-Engel, 2017). A distinctive feature of herpesviruses is their ability to establish latent infections that persist throughout the life of the host without clinically apparent signs of infection (Eberle and Jones-Engel, 2017).

The objective of the present work is to report a case of lethal infection by Herpes simplex virus 1 (HSV-1) in a captive Azara's owl monkey (Aotus azarae) in Paraguay.

Patient Examination

Anamnesis

A 2-year-old male pet Aotus azarae was brought to the Wild Animal Clinic at the Faculty of Veterinary Sciences, National University of Asunción. The animal weighed 975 grams and was in poor body condition. The individual was kept in close contact with the caretakers, either freely inside the house or tied at the waist with a nylon leash while being carried on the caretakers' shoulders. It was fed primarily by household members, sharing their meals and even engaging in mouth-to-mouth feeding. As reported by the caretaker, the animal had been asthenic and anorexic for approximately two days.

Clinical findings

On clinical inspection, the animal appeared weakened, with pale oral mucosa, a hyperemic pharynx, and a rectal temperature of 34.2°C (hypothermia). Dry crusts were observed in the perinasal region, and slight dyspnea was perceived. The patient was placed in an oxygenation chamber and died one hour later.

Diagnostic aids

Immediately after confirming the animal’s death, 3 ml of blood was extracted via cardiac puncture. Of the extracted blood, 1 ml was placed in a vial with EDTA for a hemogram, and 2 ml were placed in a vial without anticoagulant for molecular diagnostics. Both samples were refrigerated at 4°C until processing. The caretaker refused to send the patient’s body for routine post-mortem studies.

The blood sample for the hemogram was processed using the following methods: (a) Manual counting of blood cells and hemoglobin levels; (b) Differential leukocyte counting in blood smears stained with Giemsa; (c) Morphological evaluation of blood cells in blood smears stained with Giemsa; (d) Determination of total plasma protein levels by refractometry.

The results, shown in Table 1, were suggestive of normocytic normochromic anemia, leukopenia, hypoproteinemia, and thrombocytopenia, indicative of viremia.

Table 1 Hematological results from a sample taken from an Aotus azarae infected with HSV-1. 

Analyte (unit) Results Reference*
Hematocrit (%) 24.0 34.1 - 53.6
Hemoglobin (g/100 ml) 8.6 12.0 - 19.4
Red blood cells (106/mm3) 3.2 4.56 - 7.06
Mean corpuscular volume (fl) 75 71 - 83
Mean corpuscular hemoglobin (pg) 26 23 - 30
Mean corpuscular hemoglobin concentration (gr/dl) 35 32 - 39
White blood cells (106/mm3) 4300 4900 - 21000
Segmented (µ/l) 989 910 - 7190
Lymphocytes (µ/l) 3311 3140 - 10600
Monocytes (µ/l) -- 0 - 302
Eosinophils (µ/l) -- 94 - 4062
Basophils (µ/l) -- 0 - 411
Platelets (103/µl) 2.0 3.7 - 24.5
Total proteins (g/L) 4.2 6.9 - 8.1

*Takeshita et al. (2011)

From the blood sample, RNA extraction was performed using the commercial kit Ribospin vRD (GeneAll), following the manufacturer's instructions.

The primers used for HSV-1 detection were:

  • HSV-1 Forward: 5’ GCAGTTTACGTACAACCACATACAGC 3’

  • HSV-1 Reverse: 5’ AGCTTGCGGGCCTCGTT 3’

  • HSV-1 Probe: CGGCCCAACATATCGTTGACATGGC

The primers used for HSV-2 detection were:

  • HSV-2 Forward: 5’ TGCAGTTTACGTATAACCACATACAGC 3’

  • HSV-2 Reverse: 5’ AGCTTGCGGGCCTCGTT 3’

  • HSV-2 Probe: CGCCCCAGCATGTCGTTCACGT

The conditions set in the BioRad CFX96 thermal cycler were:

  • Activation: 95°C for 2 minutes

  • 40 cycles of denaturation: 95°C for 5 seconds

  • Extension: 60°C for 20 seconds

The observed result was positive for HSV-1 and negative for HSV-2.

Discussion

Given that humans and nonhuman primates (NHPs) are genetically and physiologically similar, it is not surprising that some herpesviruses from NHPs can infect humans, and vice versa. Although most of these cross-species infections are probably abortive (i.e., the virus cannot complete its replicative cycle to produce an active or latent infection or cause clinically apparent disease), some herpesviruses produce severe or lethal infections when transmitted to a non-natural host species (Eberle and Jones-Engel, 2017).

The clinical signs reported in captive primates of the genus Aotus infected with HSV-1 partially coincide with those observed in the present case, including severe dyspnea, apathy, hypothermia, and lethargy that gradually worsened until the animal's death within a period of 4 to 7 days (Melendez et al., 1969; Kreutzer et al., 2011). Reports also mention lesions in the oral cavity, including vesicles, mucous exudate, necrotic plaques, moderate multifocal gingival defects, and ulcers in the oral mucosa and tongue, which may extend to the pharynx, esophagus, and trachea (Melendez et al., 1969; Gozalo et al., 2008; Kreutzer et al., 2011). All cases report infections with high case fatality rates (Melendez et al., 1969; Meignier et al., 1990; Gozalo et al., 2008; Kreutzer et al., 2011).

In Callithrix spp., another group of NWPs, an acute course of infection has also been reported, with an evolution ranging from 1 to 8 days (Juan-Sallés et al., 1997; Huemer et al., 2002; Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007). Clinical signs are similar, including prostration, paresis, hyporexia, hypersalivation, vomiting, diarrhea, aggressiveness, seizures, nystagmus, anisocoria, and dyspnea (Huemer et al., 2002; Hatt et al., 2004; Casagrande, 2007; Imura et al., 2014). In association with the neurological signs, most animals develop small ulcers covered by crusts on the facial skin, extensive ulcers covered by whitish fibrinous material on the oral mucosa and tongue, and, in some cases, conjunctivitis (Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007; Sekulin et al., 2010; Araújo et al., 2016). Some animals exhibit neurological alterations without skin and mucosal lesions (Juan-Sallés et al., 1997; Casagrande, 2007; Imura et al., 2014), whereas others show no clinical manifestations and are found dead (Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007). In Pithecia pithecia, outbreaks of acute and fatal infection have also been reported, with animals dying within 48 to 96 hours after the onset of signs, similar to cases in Aotus spp. and Callithrix spp. (Schrenzel et al., 2003; Lapid and Eshar, 2017).

Regarding diagnostic methods, the use of serological testing for herpesvirus diagnosis should be approached with caution since many primates are asymptomatic carriers of various herpesvirus species. When histopathological examinations are performed, non-suppurative meningoencephalitis with necrotizing vasculitis and the presence of typical intranuclear inclusions are observed; however, this does not allow for the determination of the specific herpesvirus species. In contrast, immunohistochemistry using monoclonal antibodies enables differentiation of several herpesvirus species, although anti-HSV-1 and anti-HSV-2 antibodies are polyclonal and cross-react (Casagrande, 2014).

Currently, PCR is the technique of choice for the definitive diagnosis of herpesvirus species involved in diseases of humans and NHPs, although its use must be correlated with the clinical presentation and lesions of the patient. Swabs from lesions or blood samples from diseased animals can be used, as well as organs collected during necropsy (Casagrande, 2007; Casagrande, 2014). The reports by Schrenzel et al. (2003), Casagrande (2007), and Sekulin et al. (2010) detail the primers used for the detection of HSV-1 in Pithecia pithecia and Callithrix jacchus specimens, respectively.

Treatment with acyclovir does not prevent death from encephalitis in HSV-1-infected animals, although it remains the antiherpetic drug of choice in humans (Casagrande, 2014; Kukhanova et al., 2014). Other drugs used in humans include valacyclovir and ganciclovir, which could be used in NHPs (Casagrande, 2014). There is a single report of a Callithrix jacchus surviving a natural HSV-1 infection and recovering spontaneously without treatment (Hatt et al., 2004).

It should be noted that HSV-1 infection in NHPs is an anthropozoonotic disease, and the present report coincides with acute spontaneous HSV-1 infections described as fatal in Aotus spp. and Callithrix spp. following contact with a person carrying HSV-1 (Mätz-Rensing et al., 2003), being kept as a pet in close contact with its owners (Juan-Sallés et al., 1997; Huemer et al., 2002; Hatt et al., 2004; Kreutzer et al., 2011; Imura et al., 2014), or even sharing food with the animal (Araújo et al., 2016). HSV-1 infection in NWPs has already been widely reported in Brazil, affecting animals from zoos, conservation and breeding centers, and research facilities, as well as pet primates, particularly those of the genus Callithrix (Casagrande, 2007). A study conducted in Peru on primates kept as pets found that 50.4% of individuals sought veterinary consultation for infectious diseases, while 11.4% were presented with both infectious and non-infectious conditions simultaneously (Nolasco, 2017), highlighting the potential impact of household primate ownership on public health.

Conclusion

Data obtained through anamnesis and clinical history, as well as observable signs during the physical examination, hematological findings, and PCR results, confirmed the diagnosis of HSV-1 infection as the cause of death in a captive Azara’s owl monkey. To the authors' best knowledge, this is the first report of the disease in a non-human primate in Paraguay.

Aknowledgements

Special thanks to Thomas Goossen (Asociación Paraguaya de Mastozoología), Lorena Núñez and Lourdes Narváez (División Laboratorio de Biotecnología Animal, Departamento de Clínicas Veterinarias, FCV-UNA), Nicolás Aguayo.

References

Araújo JL, Frade MTS, Melo CMF, dos Santos Carneiro R, Galiza GJN, Olinda RG, Lucena RB, Dantas AFM Infecção sistêmica por herpesvírus simples em um sagui-de tufo-branco (Callithrix jacchus) no semiárido da Paraíba. Veterinária e Zootecnia 2016; 23(2):203-208. https://pesquisa.bvsalud.org/portal/resource/pt/vti-762783Links ]

Barahona H, Melendez LV, Hunt RD, Daniel MD The owl monkey (Aotus trivirgatus) as an animal model for viral diseases and oncologic studies. Lab Anim Sci 1976; 26(6):1104-1112. https://pubmed.ncbi.nlm.nih.gov/190472/Links ]

Calle PP, Joslin JO New world and old world monkeys. In: Miller E, Fowler M, editors. Zoo and Wild Animal Medicine. 8th ed. St Louis: Elsevier Saunders; 2015. 301-335. https://doi.org/10.1016/B978-1-4557-7397-8.00037-2 [ Links ]

Casagrande RA Herpesvirus simplex Tipo 1 (HSV-1) em sagüis (Callithrix jacchus e Callithrix penicillata) - Caracterização anatomopatológica e molecular. Doctoral dissertation. São Paulo: Universidade de São Paulo; 2007. https://doi.org/10.11606/D.10.2007.tde-20082007-133334 [ Links ]

Casagrande RA Herpesviroses em Primatas. In: Cubas ZS, Ramos Silva JC, Catao-Dias JL, editors. Tratado de Animais Selvagens. 2nd ed. Rio de Janeiro: Roca; 2014. 1321-1336. [ Links ]

Eberle R, Jones-Engel L Understanding primate herpesviruses. J Emerging Dis Virol 2017; 3(1). https://doi.org/10.16966/2473-1846.127 [ Links ]

Fortman JD, Hewett TA, Halliday LC The laboratory nonhuman primate. 2nd ed. Florida: CRC Press; 2018. https://doi.org/10.1201/9781315117065 [ Links ]

Gozalo AS, Montoya EZ, Weller RE Dyscoria associated with herpesvirus infection in owl monkeys (Aotus nancymae). J Am Assoc Lab Anim Sci 2008; 47(4):68-71. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2694719/Links ]

Hatt JM, Grest P, Posthaus H, Bossart W Serologic survey in a colony of captive common marmosets (Callithrix jacchus) after infection with herpes simplex type 1-like virus. J Zoo Wildl Med 2004; 35(3):387-390. https://doi.org/10.1638/03-041 [ Links ]

Huemer HP, Larcher C, Czedik-Eysenberg T, Nowotny N, Reifinger M Fatal infection of a pet monkey with human herpesvirus 1. Emerg Infect Dis 2002; 8(6):639-641. https://doi.org/10.3201/eid0806.010341 [ Links ]

Imura K, Chambers JK, Uchida K, Nomura S, Suzuki S, Nakayama H, Miwa Y Herpes simplex virus type 1 infection in two pet marmosets in Japan. J Vet Med Sci 2014; 76(12):1667-1670. https://doi.org/10.1292/jvms.14-0374 [ Links ]

Juan-Sallés C, Ramos-Vara JA, Prats N, Solé-Nicolás J, Segalés J, Marco AJ Spontaneous herpes simplex virus infection in common marmosets (Callithrix jacchus). J Vet Diagn Invest 1997; 9(3):341-345. https://doi.org/10.1177/104063879700900325 [ Links ]

Katzin DS, Connor JD, Wilson LA, Sexton RS Experimental herpes simplex infection in the owl monkey. Proc Soc Exp Biol Med 1967; 125(2):391-398. https://doi.org/10.3181/00379727-125-32100 [ Links ]

Kreutzer R, Kreutzer M, Günther CP, Mätz‐Rensing K, Wohlsein P Systemic herpesvirus infection in an Azara’s Night Monkey (Aotus azarae). J Med Primatol 2011; 40(3):197-199. https://doi.org/10.1111/j.1600-0684.2011.00469.x [ Links ]

Kukhanova MK, Korovina AN, Kochetkov SN Human herpes simplex virus: life cycle and development of inhibitors. Biochem (Mosc) 2014; 79:1635-1652. https://doi.org/10.1134/S0006297914130124 [ Links ]

Lapid R, Eshar D Fatal Herpes simplex virus 1 (HSV-1) infection in a group of zoo-kept white-faced saki monkeys (Pithecia pithecia) in Israel. Isr J Vet Med 2017; 72:51-55. https://www.ijvm.org.il/node/529Links ]

Ludlage E, Mansfield K Clinical care and diseases of the common marmoset (Callithrix jacchus). Comp Med 2003; 53(4):369-382. https://pubmed.ncbi.nlm.nih.gov/14524413/Links ]

Mätz-Rensing K, Jentsch KD, Rensing S, Langenhuyzen S, Verschoor E, Niphuis H, Kaup FJ Fatal Herpes simplex infection in a group of common marmosets (Callithrix jacchus). Vet Pathol 2003; 40(4):405-411. https://doi.org/10.1354/vp.40-4-405 [ Links ]

Meignier B, Martin B, Whitley RJ, Roizman B In vivo behavior of genetically engineered herpes simplex viruses R7017 and R7020. II. Studies in immunocompetent and immunosuppressed owl monkeys (Aotus trivirgatus). J Infect Dis 1990; 162(2):313-321. https://doi.org/10.1093/infdis/162.2.313 [ Links ]

Melendez LV, Espana C, Hunt RD, Daniel MD, Garcia FG Natural herpes simplex infection in the owl monkey (Aotus trivirgatus). Lab Anim Care 1969; 19(1):38-45. https://pubmed.ncbi.nlm.nih.gov/4304237/Links ]

Nolasco Chumpitaz CE Estudio retrospectivo de las historias clínicas de primates atendidos en el consultorio de animales silvestres y exóticos de la Facultad de Medicina Veterinaria, Universidad Nacional Mayor de San Marcos, durante el período 2005-2014. Undergraduate dissertation. Universidad Nacional Mayor de San Marcos; 2017. https://hdl.handle.net/20.500.12672/7254Links ]

Roth JC, Cassady KA, Cody JJ, Parker JN, Price KH, Coleman JM, Peggins JO, Noker PE, Powers NW, Grimes SD, Carroll SL, Gillespie GY, Whitley RJ, Markert JM Evaluation of the safety and biodistribution of M032, an attenuated herpes simplex virus type 1 expressing hIL-12, after intracerebral administration to Aotus nonhuman primates. Hum Gene Ther Clin Development 2014; 25(1):16-27. https://doi.org/10.1089/humc.2013.201 [ Links ]

Schrenzel MD, Osborn KG, Shima A, Klieforth RB, Maalouf GA Naturally occurring fatal herpes simplex virus 1 infection in a family of white‐faced saki monkeys (Pithecia pithecia pithecia). J Med Primatol 2003; 32(1):7-14. https://doi.org/10.1034/j.1600-0684.2003.01040.x [ Links ]

Sekulin K, Jankova J, Kolodziejek J, Huemer HP, Gruber A, Meyer J, Nowotny N Natural zoonotic infections of two marmosets and one domestic rabbit with herpes simplex virus type 1 did not reveal a correlation with a certain gG-, gI- or gE genotype. Clin Microbiol Infect 2010; 16(11):1669-1672. https://doi.org/10.1111/j.1469-0691.2010.03163.x [ Links ]

Souvignet T, Giorgiadis M, Drouet B, Quintard B EAZA Best Practice Guidelines capuchin monkeys (Sapajus and Cebus sp.). Mulhouse: European Association of Zoos and Aquaria; 2019. https://strapi.eaza.net/uploads/20190828_Best_Practice_Guideline_Capuchins_NV_6f6ea5ceb4.pdfLinks ]

Takeshita RSC, Monteiro FOB, de Miranda Lins e Lins FL, da Silva GA, Faturi C, Coutinho LN, Monteiro MVB, Kugelmeier T, de Castro PHG, Muniz JAPC Hematological, hepatic, and renal evaluation in Aotus azarai infulatus. J Med Primatol 2011; 40(2):104-110. https://doi.org/10.1111/j.1600-0684.2010.00452.x [ Links ]

Todo T, Feigenbaum F, Rabkin SD, Lakeman F, Newsome JT, Johnson PA, Mitchell E, Belliveau D, Ostrove JM, Martuza RL Viral shedding and biodistribution of G207, a muitimutated, conditionally replicating herpes simplex virus type 1, after intracerebral inoculation in Aotus. Mol Ther 2000; 2(6):588-595. https://doi.org/10.1006/mthe.2000.0200 [ Links ]

Wertheim JO, Smith MD, Smith DM, Scheffler K, Kosakovsky Pond SL Evolutionary origins of human herpes simplex viruses 1 and 2. Mol Biol Evol 2014; 31(9):2356-2364. https://doi.org/10.1093/molbev/msu185 [ Links ]

Zinsser H Herpes encephalitis in Cebus monkeys. J Exp Med 1929; 49(4):661-670. https://doi.org/10.1084/jem.49.4.661 [ Links ]

Declarations

Funding This study was financed by the authors’ own resources. There was no financial support by any of the companies mentioned in this report.

Use of artificial intelligence (AI) No AI or AI-assisted technologies were used during the preparation of this work.

To cite this article: Vetter JR, Florentín-Morel M, Riera-Domínguez MG, Cañiza RG. Lethal infection by herpes simplex virus 1 (HSV-1) in a captive Azara's owl monkey (Aotus azarae) in Paraguay. Rev Colomb Cienc Pecu. 2025; 38(2): e3835. DOI: https://doi.org/10.17533/udea.rccp.38n3a5

Received: December 10, 2023; Accepted: August 30, 2024

*Corresponding author: Departamento de Recursos Faunísticos y Medio Natural, Facultad de Ciencias Veterinarias, Universidad Nacional de Asunción, Highway PY02, km 13,5, San Lorenzo 111421, Paraguay. E-mail: jvetter@vet.una.py

Conflicts of interest

The authors declare they have no conflicts of interest regarding the work presented in this report.

Author contributions

J. Richard Vetter: study conception, data collection, wrote the paper. Marlene Florentín-Morel: data collection, critical review of the paper. MaríaGraciela Riera-Domínguez: data collection, wrote the paper. Ricardo G. Cañiza: data collection, critical review of the paper.

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License