Resumo

RAMOS-HERNANDEZ, Eder et al. Cixiidae and Derbidae (Hemiptera) putative vectors of phytoplasma of group 16 SrIV. Rev. Colomb. Entomol. [online]. 2020, vol.46, n.2, e7065.  Epub 31-Dez-2020. ISSN 0120-0488.  https://doi.org/10.25100/socolen.v46i2.7065.

The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.

Palavras-chave : Palms; PCR real time; phytoplasma vector; Haplaxius crudus; Haplaxius skarphion; Oecleus snowi; Persis foveatis; Cixiidae; Derbidae; Hemiptera.

        · resumo em Espanhol     · texto em Espanhol     · Espanhol ( pdf )