Introduction
Herpesviruses are DNA-enveloped viruses with complex genomes that infect a wide variety of vertebrate species, with many primates and humans being natural hosts (Ludlage and Mansfield, 2003; Casagrande, 2014). Formerly classified within the family Herpesviridae, these viruses are now grouped into three families within the order Herpesvirales: the family Herpesviridae, which retains all mammalian, avian, and reptile herpesviruses; the new family Alloherpesviridae, comprising fish and frog viruses; and the new family Malacoherpesviridae, containing the viruses of bivalves. The family Herpesviridae is further divided into three subfamilies, among which are the 39 known species of human and non-human primate herpesviruses (Casagrande, 2014).
The genus Simplexvirus, within the subfamily Alphaherpesvirinae, contains five species of New World Primate herpesviruses (NWP), as well as two species of human herpesviruses: Herpes simplex virus 1 (HSV-1) and Herpes simplex virus 2 (HSV-2). Many human and non-human primates carry their own species of herpesviruses belonging to this genus, which normally do not cause clinical disease in immunocompetent natural hosts (Casagrande, 2014). Humans are the only primate species infected by two distinct Herpes simplex viruses: HSV-1 and HSV-2 (Wertheim et al., 2014). Herpesviruses have been infecting and coevolving with their vertebrate hosts for hundreds of millions of years (Wertheim et al., 2014). However, when these viruses infect different primate species, they can cause significant and often fatal clinical disease (Casagrande, 2014).
Unlike Old World Primates (OWP), which generally develop a self-limiting infection similar to that in humans, NWPs are more susceptible to HSV-1 infection, typically presenting a generalized and fatal disease characterized by anorexia, dermatitis, pruritus, depression, and ulcerative lesions in the oral cavity and gastrointestinal tract (Casagrande, 2014; Fortman et al., 2018). The disease caused by these viruses has been reported in captive NWPs of the genus Cebus (Zinsser, 1929; Souvignet, 2019), Aotus (Katzin, 1967; Barahona et al., 1976; Meignier et al., 1990; Gozalo et al., 2008; Kreutzer et al., 2011), Callithrix (Huemer et al., 2002; Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007; Sekulin et al., 2010; Imura et al., 2014; Araújo et al., 2016), and Pithecia (Schrenzel et al., 2003; Lapid and Eshar, 2017). Primates of the genus Aotus are known for their high susceptibility to HSV infection, in which the virus appears to have a predilection for the cerebral cortex, causing encephalitis (Calle and Joslin, 2015). For this reason, these primates are also used as a model for the study of the pathogen (Katzin et al., 1967; Todo et al., 2000; Roth et al., 2014).
Because of the frequent but unapparent spread of herpesviruses, careful handling of these animals should be recommended, and appropriate hygiene measures should be applied for the sake of both owners and pet monkeys. Standard veterinary practice considers whether diseases of primates that have been in close contact with humans may have been caused by human viruses (Huemer et al., 2002). In addition to considering the transmission of NWP herpesviruses, such as CeHV-1, to a human host, which can result in potentially fatal encephalitis (Casagrande, 2007), the potential link between a wild animal and an infection acquired from a human host should be highlighted, as humans in contact with the animal may not necessarily show signs of disease (Huemer et al., 2002). This occurs because herpesviruses typically do not cause severe infections in immunocompetent individuals of their natural host species, as most infections remain asymptomatic (Eberle and Jones-Engel, 2017). A distinctive feature of herpesviruses is their ability to establish latent infections that persist throughout the life of the host without clinically apparent signs of infection (Eberle and Jones-Engel, 2017).
The objective of the present work is to report a case of lethal infection by Herpes simplex virus 1 (HSV-1) in a captive Azara's owl monkey (Aotus azarae) in Paraguay.
Patient Examination
Anamnesis
A 2-year-old male pet Aotus azarae was brought to the Wild Animal Clinic at the Faculty of Veterinary Sciences, National University of Asunción. The animal weighed 975 grams and was in poor body condition. The individual was kept in close contact with the caretakers, either freely inside the house or tied at the waist with a nylon leash while being carried on the caretakers' shoulders. It was fed primarily by household members, sharing their meals and even engaging in mouth-to-mouth feeding. As reported by the caretaker, the animal had been asthenic and anorexic for approximately two days.
Clinical findings
On clinical inspection, the animal appeared weakened, with pale oral mucosa, a hyperemic pharynx, and a rectal temperature of 34.2°C (hypothermia). Dry crusts were observed in the perinasal region, and slight dyspnea was perceived. The patient was placed in an oxygenation chamber and died one hour later.
Diagnostic aids
Immediately after confirming the animal’s death, 3 ml of blood was extracted via cardiac puncture. Of the extracted blood, 1 ml was placed in a vial with EDTA for a hemogram, and 2 ml were placed in a vial without anticoagulant for molecular diagnostics. Both samples were refrigerated at 4°C until processing. The caretaker refused to send the patient’s body for routine post-mortem studies.
The blood sample for the hemogram was processed using the following methods: (a) Manual counting of blood cells and hemoglobin levels; (b) Differential leukocyte counting in blood smears stained with Giemsa; (c) Morphological evaluation of blood cells in blood smears stained with Giemsa; (d) Determination of total plasma protein levels by refractometry.
The results, shown in Table 1, were suggestive of normocytic normochromic anemia, leukopenia, hypoproteinemia, and thrombocytopenia, indicative of viremia.
Table 1 Hematological results from a sample taken from an Aotus azarae infected with HSV-1.
| Analyte (unit) | Results | Reference* |
|---|---|---|
| Hematocrit (%) | 24.0 | 34.1 - 53.6 |
| Hemoglobin (g/100 ml) | 8.6 | 12.0 - 19.4 |
| Red blood cells (106/mm3) | 3.2 | 4.56 - 7.06 |
| Mean corpuscular volume (fl) | 75 | 71 - 83 |
| Mean corpuscular hemoglobin (pg) | 26 | 23 - 30 |
| Mean corpuscular hemoglobin concentration (gr/dl) | 35 | 32 - 39 |
| White blood cells (106/mm3) | 4300 | 4900 - 21000 |
| Segmented (µ/l) | 989 | 910 - 7190 |
| Lymphocytes (µ/l) | 3311 | 3140 - 10600 |
| Monocytes (µ/l) | -- | 0 - 302 |
| Eosinophils (µ/l) | -- | 94 - 4062 |
| Basophils (µ/l) | -- | 0 - 411 |
| Platelets (103/µl) | 2.0 | 3.7 - 24.5 |
| Total proteins (g/L) | 4.2 | 6.9 - 8.1 |
From the blood sample, RNA extraction was performed using the commercial kit Ribospin vRD (GeneAll), following the manufacturer's instructions.
The primers used for HSV-1 detection were:
HSV-1 Forward: 5’ GCAGTTTACGTACAACCACATACAGC 3’
HSV-1 Reverse: 5’ AGCTTGCGGGCCTCGTT 3’
HSV-1 Probe: CGGCCCAACATATCGTTGACATGGC
The primers used for HSV-2 detection were:
HSV-2 Forward: 5’ TGCAGTTTACGTATAACCACATACAGC 3’
HSV-2 Reverse: 5’ AGCTTGCGGGCCTCGTT 3’
HSV-2 Probe: CGCCCCAGCATGTCGTTCACGT
The conditions set in the BioRad CFX96 thermal cycler were:
Activation: 95°C for 2 minutes
40 cycles of denaturation: 95°C for 5 seconds
Extension: 60°C for 20 seconds
The observed result was positive for HSV-1 and negative for HSV-2.
Discussion
Given that humans and nonhuman primates (NHPs) are genetically and physiologically similar, it is not surprising that some herpesviruses from NHPs can infect humans, and vice versa. Although most of these cross-species infections are probably abortive (i.e., the virus cannot complete its replicative cycle to produce an active or latent infection or cause clinically apparent disease), some herpesviruses produce severe or lethal infections when transmitted to a non-natural host species (Eberle and Jones-Engel, 2017).
The clinical signs reported in captive primates of the genus Aotus infected with HSV-1 partially coincide with those observed in the present case, including severe dyspnea, apathy, hypothermia, and lethargy that gradually worsened until the animal's death within a period of 4 to 7 days (Melendez et al., 1969; Kreutzer et al., 2011). Reports also mention lesions in the oral cavity, including vesicles, mucous exudate, necrotic plaques, moderate multifocal gingival defects, and ulcers in the oral mucosa and tongue, which may extend to the pharynx, esophagus, and trachea (Melendez et al., 1969; Gozalo et al., 2008; Kreutzer et al., 2011). All cases report infections with high case fatality rates (Melendez et al., 1969; Meignier et al., 1990; Gozalo et al., 2008; Kreutzer et al., 2011).
In Callithrix spp., another group of NWPs, an acute course of infection has also been reported, with an evolution ranging from 1 to 8 days (Juan-Sallés et al., 1997; Huemer et al., 2002; Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007). Clinical signs are similar, including prostration, paresis, hyporexia, hypersalivation, vomiting, diarrhea, aggressiveness, seizures, nystagmus, anisocoria, and dyspnea (Huemer et al., 2002; Hatt et al., 2004; Casagrande, 2007; Imura et al., 2014). In association with the neurological signs, most animals develop small ulcers covered by crusts on the facial skin, extensive ulcers covered by whitish fibrinous material on the oral mucosa and tongue, and, in some cases, conjunctivitis (Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007; Sekulin et al., 2010; Araújo et al., 2016). Some animals exhibit neurological alterations without skin and mucosal lesions (Juan-Sallés et al., 1997; Casagrande, 2007; Imura et al., 2014), whereas others show no clinical manifestations and are found dead (Mätz-Rensing et al., 2003; Hatt et al., 2004; Casagrande, 2007). In Pithecia pithecia, outbreaks of acute and fatal infection have also been reported, with animals dying within 48 to 96 hours after the onset of signs, similar to cases in Aotus spp. and Callithrix spp. (Schrenzel et al., 2003; Lapid and Eshar, 2017).
Regarding diagnostic methods, the use of serological testing for herpesvirus diagnosis should be approached with caution since many primates are asymptomatic carriers of various herpesvirus species. When histopathological examinations are performed, non-suppurative meningoencephalitis with necrotizing vasculitis and the presence of typical intranuclear inclusions are observed; however, this does not allow for the determination of the specific herpesvirus species. In contrast, immunohistochemistry using monoclonal antibodies enables differentiation of several herpesvirus species, although anti-HSV-1 and anti-HSV-2 antibodies are polyclonal and cross-react (Casagrande, 2014).
Currently, PCR is the technique of choice for the definitive diagnosis of herpesvirus species involved in diseases of humans and NHPs, although its use must be correlated with the clinical presentation and lesions of the patient. Swabs from lesions or blood samples from diseased animals can be used, as well as organs collected during necropsy (Casagrande, 2007; Casagrande, 2014). The reports by Schrenzel et al. (2003), Casagrande (2007), and Sekulin et al. (2010) detail the primers used for the detection of HSV-1 in Pithecia pithecia and Callithrix jacchus specimens, respectively.
Treatment with acyclovir does not prevent death from encephalitis in HSV-1-infected animals, although it remains the antiherpetic drug of choice in humans (Casagrande, 2014; Kukhanova et al., 2014). Other drugs used in humans include valacyclovir and ganciclovir, which could be used in NHPs (Casagrande, 2014). There is a single report of a Callithrix jacchus surviving a natural HSV-1 infection and recovering spontaneously without treatment (Hatt et al., 2004).
It should be noted that HSV-1 infection in NHPs is an anthropozoonotic disease, and the present report coincides with acute spontaneous HSV-1 infections described as fatal in Aotus spp. and Callithrix spp. following contact with a person carrying HSV-1 (Mätz-Rensing et al., 2003), being kept as a pet in close contact with its owners (Juan-Sallés et al., 1997; Huemer et al., 2002; Hatt et al., 2004; Kreutzer et al., 2011; Imura et al., 2014), or even sharing food with the animal (Araújo et al., 2016). HSV-1 infection in NWPs has already been widely reported in Brazil, affecting animals from zoos, conservation and breeding centers, and research facilities, as well as pet primates, particularly those of the genus Callithrix (Casagrande, 2007). A study conducted in Peru on primates kept as pets found that 50.4% of individuals sought veterinary consultation for infectious diseases, while 11.4% were presented with both infectious and non-infectious conditions simultaneously (Nolasco, 2017), highlighting the potential impact of household primate ownership on public health.
Conclusion
Data obtained through anamnesis and clinical history, as well as observable signs during the physical examination, hematological findings, and PCR results, confirmed the diagnosis of HSV-1 infection as the cause of death in a captive Azara’s owl monkey. To the authors' best knowledge, this is the first report of the disease in a non-human primate in Paraguay.














