SciELO - Scientific Electronic Library Online

 
vol.29 issue2Implementation of an internal control in molecular detection of the main mycoplasma species contaminating cell culturesGenetics Biomarckers off the MHC/HLA-DRB1* and PTPN 22 Systems Associated to Rheumatics diseases: idiopatic juvenile arthritis and rheumatoid of early installation. A descriptive approach in a pilot study author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista Salud Uninorte

Print version ISSN 0120-5552

Salud, Barranquilla vol.29 no.2 Barranquilla May/Aug. 2013

 

Artículo original / ORIGINAL ARTICLE

Comparación de los métodos de inmunoensayo enzimático automatizado (VIDAS) y PCR para la detección de Salmonella spp. en expendios de la ciudad de Santa Marta (Colombia)

Comparison between the Vitek immunodiagnostic Assay System and PCR for the detection of Salmonella spp. in foods

Libardo Acosta1, Jair Pinedo2, Enio Hernández3, José Villarreal4

Correspondencia: Universidad Cooperativa de Colombia, Programa de Medicina. Troncal del Caribe, km1, vía Mamatoco. Santa Marta (Magdalena). joseluisvillarrealcamacho@hotmail.com

Fecha de recepción: 21 de marzo de 2013
Fecha de aceptación: 17 de mayo de 2013


Resumen

Objetivo: comparar los métodos de inmunoensayo enzimático automatizado vidas, (Vitek Immunodiagnostic Assay System), y el análisis molecular por Reacción en Cadena de la Polimerasa (pcr) para detectar Salmonella spp en expendios de la ciudad de Santa Marta (Colombia).

Materiales y métodos: Previamente se reportó la estandarización de la técnica de pcr para la detección de Salmonella spp. en un lapso de 12 horas. En colaboración con el Labo ratorio de Salud Pública del departamento del Magdalena se procedió a tomar un total de 65 muestras de alimentos para análisis de vigilancia rutinaria, discriminados así: carne de res: 14 (21.5 %), embutidos: 18 (27.7 %), pollo: 7(10.8 %), pescado: 3(4.6 %), harinas: 13 (20 %), lácteos: 5 (7.7 %) salsas: 4(6.2 %) y ensalada: 1(1.5 %), en la ciudad de Santa Marta entre septiembre y noviembre de 2010. Las 65 muestras fueron sometidas a análisis microbiológico para la determinación de Salmonella spp. en el Laboratorio de Salud Pública del departamento del Magdalena siguiendo el protocolo del vidas. Una alícuota de 1 mL del preenriquecimiento no selectivo fue enviada refrigerada al laboratorio de biología molecular de la Universidad Cooperativa de Colombia para ser analizada por pcr.

Resultados: Los resultados muestran que los alimentos analizados en el Laboratorio de Salud Pública del departamento del Magdalena con vidas presentaron Salmonella spp. únicamente en cárnicos: 5/65 (7.7 %), mientras que esas mismas muestras analizadas por pcr mostraban la presencia de Salmonella spp. en 36/65 (55.4 %).

Conclusiones: Los resultados indican que la pcr puede ser aplicada para realizar vigilancia epidemiológica y obtener resultados cualitativos confiables en menor tiempo.

Palabras clave: Salmonella, pcr, vigilancia epidemiológica.


Abstract

Objectives: To compare the methods of the automated Immunodiagnostic Assay System and the Polymerase Chain Reaction (PCR) to detect Salmonella spp. In food sold in the city of Santa Marta -Colombia.

Materials and methods: The standardization of the PCR for detecting Salmonella spp was previously reported by us within 12 hours. The determinations were carried out with the help of the Public Health Laboratory of Magdalena, Colombia. 65 samples of food were studied: beef 14(21.5%), sausages 18(27.7%), chicken 7(10.8%), fish 3(4.6%), flours 13(20%), dairy products 5(7.7%) sauces 4(6.2%) y salads 1(1.5%) in the city of Santa Marta - Colombia between September and November 2010. A microbiological analysis was done on the 65 samples to determine Salmonella spp. in the Public Health Laboratory of Magdalena according to protocol of automated Vitek Immunodiagnostic Assay System. An aliquot of no selective pre-enrichment was sent to the molecular biology laboratory of Cooperativa de Colombia University to be analyzed for PCR.

Results: The results show that the food analyzed in the public health laboratory presented Salmonella spp. only in sausages 5/65 (7.7%), while these samples analyzed using PCR showed Salmonella spp. in 36/65 (55.4%).

Conclusions: The results indicate that PCR can be applied to get faster and better results to do regular epidemiological studies.

Key words: Salmonella, PCR Epidemiological Surveillance.


Introducción

De Salmonella se lleva a cabo en dos medios diferenciales usados simultáneamente. La Association of Official Analytical Chemist (AOAC) (4) describe los pasos que se deben seguir para obtener buenos resultados, los cuales pueden demorar entre 4 a 5 días. Sin embargo, la recuperación de Salmonella spp. se dificulta porque: primero, no es detectable en alimentos que tienen un bajo número de células (5), y segundo, los métodos tradicionales para la recuperación del microorganismo, aislamiento en medios selectivos, posterior identificación bioquímica y caracterización serológica tienen baja especificidad, sensibilidad y consumen mucho tiempo. La implementación de técnicas como la (PCR), la hibridación, el uso de biochips y de enzimas de restricción, entre otras, ha facilitado el diagnóstico microbiológico molecu-

La Salmonella es uno de los principales agentes causantes de intoxicaciones alimentarias a nivel mundial (1). Dicha bacteria es cada vez más resistente a los antibióticos comunes, se multiplica a bajas temperaturas y responde efectivamente a los cambios del medio (2) y puede colonizar a la mayoría de los animales, incluyendo aves, reptiles, ganado, roedores y el ser humano (3). Los métodos microbiológicos tradicionales para la detección de Salmonella no están encaminados al conteo de esta bacteria, debido a que es considerada una técnica cuyo resultado se expresa cualitativamente, determinando su presencia o ausencia en diferentes matrices, pues la identificación o confirmación de las colonias presuntivas larvas de patógenos en alimentos. Actualmente se ha extendido la implementación de estas nuevas tecnologías después de una etapa previa de enriquecimiento de la muestra, lo cual ha demostrado una alta probabilidad de detectar un bajo número de células (6).

El diagnóstico serológico es importante desde el punto de vista epidemiológico, debido a que permite distinguir o caracterizar las serovariedades prevalentes en distintas zonas geográficas. Se fundamenta en la detección de los antígenos somáticos de superficie y antígenos flagelares, diferentes en cada serovariedad por el uso de anticuerpos que se unen de manera específica a un antígeno determinado. El VIDAS (Vitek Immunodiagnostic Assay System) detecta secuencial y automáticamente a Salmonella, basándose en la especificidad y afinidad de un anticuerpo monoclonal, fijado a una fase estacionaria, por el antígeno somático (O) y antígeno flagelar (H) de este microorganismo. El 4-methyl-umbelliferyl phosphate es convertido por el conjugado enzimático en un producto fluorescente: 4-methyl-umbelliferone. La intensidad de la fluorescencia emitida es leída y expresada como unidades de fluorescencia relativa (Rf). Valores por encina de 0.23 Rf son considerados como presuntivamente positivos para Salmonella (7).

El objetivo de este estudio fue comparar los métodos de inmunoensayo enzimático automatizado y análisis molecular por PCR para la detección de Salmonella spp. en expendios de la ciudad de Santa Marta.

Materiales y métodos

Recolección de la muestra

En colaboración con el Laboratorio de Salud Pública del departamento del Magdalena se procedió a tomar un total de 65 muestras de alimentos para análisis de vigilancia rutinaria, discriminados así: carne de res: 14 (21.5 %), embutidos: 18 (27.7 %), pollo: 7 (10.8 %), pescado: 3 (4.6 %), harinas: 13 (20 %), lácteos: 5 (7.7 %), salsas: 4 (6.2 %) y ensalada: 1 (1.5 %), en la ciudad de Santa Marta entre septiembre y noviembre de 2010.

Detección de Salmonella sp. en alimentos

Método de inmunoensayo enzimático automatizado

Las 65 muestras fueron sometidas a análisis microbiológico para la determinación de Salmonella spp. en el Laboratorio de Salud Pública del departamento del Magdalena. 25 mL o 25 g de muestra fueron inoculados a 225 mL de agua peptonada e incubada a 37°C durante 18 - 24 horas, siguiendo el protocolo del método de inmunoensayo enzimático automatizado (VIDAS) (7). Una alícuota de 1 mL del preenriquecimiento fue enviada refrigerada al laboratorio de biología molecular de la Universidad Cooperativa de Colombia para ser analizada por PCR (figura 1).

Análisis molecular Extracción de ADN

Se aplicó el método de fenol: cloroformo: alcohol isoamílico; para esto se resuspendió la biomasa en 600 μL de tampón TE 1X más SDS a una concentración final de 0.5 % P/V y 2 mg/mL de lisozima A. Esta mezcla se incubó durante 30 minutos a 37°C. Para eliminar los péptidos y lípidos residuales se adicionaron 80 μL de una solución NaCl 5M más 100 μL de acetato de amonio 3 M y se incubó nuevamente durante 10 minutos a 65°C. La suspensión resultante se trató con una mezcla de fenol: cloroformo: alcohol isoamílico 25:24:1. Una vez separadas las fases mediante centrifugación, la fase acuosa fue tratada con etanol absoluto y el precipitado (ADN) fue lavado con etanol al 70 % V/V, secado a 56°C por una hora y resuspendido en 20 uL de agua (8, 9).

Desarrollo de la PCR

Se amplificó una región del gen InvA de Salmonella de 284 pb con los oligonucleótidos 139 (5' GTGAAATTATCGCCACGTTCGGGCAA 3') y 141 (5' TCATCGCACCGTCAAAGGAACC 3') (10). La PCR se llevó a cabo en un volumen final de 20 μL, que contenía tampon para PCR 1X (20 mM de Tris-HCl [pH 8.4] 50 mM de KCl), MgCl2 (1 mM, 1.5 mM, 2 mM y 2.5 mM), dNTP 0.2 mM, 0.5 μM de cada oligonucleótido, 0.75 U de GoTaq ADN pol. (Promega®, Madison WI 53711, USA), más 5 uL de ADN o muestra. El blanco contenía la misma mezcla, excepto la muestra de ADN; como control positivo se empleó ADN de cepas puras de Salmonella entérica serovar typhimurium y como control negativo el ADN de Klebsiella pneumoniae. Los controles fueron incluidos en todos los experimentos. Se empleó un termociclador TC-3000 (Techne Inc. 3 Terri Lane Suite 10 Burlington NJ 08016 USA), programado de la siguiente manera: una desnaturalización inicial de 2' a 95°C, seguidos de 30 ciclos compuestos por 1' a 95°C, 1' a 59.9°C, 1' a 72°C y un paso final de extensión de 5' a 72°C. 10 uL de cada producto de PCR y 5 uL del marcador de peso molecular HyperLadder IVTM (Bioline, USA Inc.) fueron cargados en gel de agarosa al 1 % durante 1.5 horas a 60 V, tincionado con bromuro de etidio a una concentración final de 0.5 μg/mL y fotografiado sobre iluminación UV (11).

Resultados

Un total de 65 muestras de alimentos fueron tomadas en la ciudad de Santa Marta entre septiembre y noviembre de 2010, en colaboración con el Laboratorio de Salud Pública del departamento del Magdalena. Las muestras analizadas con el método de inmunoensayo enzimático automatizado en dicho laboratorio presentaron Salmonella sp. únicamente en el grupo de cárnicos: 5 (7.7 %), los demás grupos de alimentos no presentaban Salmonella sp. (92.3 %).

Sin embargo, esas mismas muestras analizadas por PCR mostraban la presencia de Salmonella sp. en 36(55.4 %) diferentes tipos de alimentos: carne de res: 8 (12.3 %), embutidos: 10 (15.4 %), pollo: 4(6.2 %), pescado: 2 (3.1 %), harinas: 6 (9.2 %), lácteos: 4(6.2 %), salsas: 1(1.5 %) y ensaladas: 1(1.5 %), como se observa en la Tabla 1.

Figura 1
Tabla 1

Discusión

Numerosas técnicas moleculares, como la hibridación con sondas, el uso de biochips, enzimas de restricción y PCR, han sido aplicadas para la detección y diagnóstico molecular de patógenos como Salmonella spp. en alimentos. La más utilizada es la PCR y se ha evaluado la selectividad (12), la especificidad y la sensibilidad de esta frente a la prueba microbiológica, la cual es considerada como la prueba de oro. Entre septiembre y noviembre de 2010 se analizaron en Santa Marta 65 muestras de alimentos, de los cuales 36 (55.4 %) mostraban amplificación de una banda de 284 pb correspondientes al gen InvA, lo cual indica la presencia de Salmonella spp. en carne de res: 8(12.3 %), embutidos: 10(15.4 %), pollo: 4(6.2 %) y pescado: 2(3.1 %), lo que indica que Salmonella se encuentra con mayor frecuencia en los cárnicos, los cuales representaban el 64.6 % del total de las muestras analizadas.

En este trabajo también se analizaron varios grupos de alimentos, como harinas: 13(20 %), lácteos: 5(7.7 %), salsas: 4(6.2 %) y ensaladas: 1(1.5 %), que representaban el 35.4 % de las muestras analizadas, y se encontró Salmonella en 6 (9.2 %), 4(6.2 %), 1(1.5 %) y 1(1.5 %), respectivamente (Tabla 1).

Los primeros estudios para la detección molecular de Salmonella, amplificando el gen invA, fueron realizados por Galán et al. en 1991 (13); desde entonces esta técnica ya se encuentra optimizada y estandarizada en países como Suecia (14), Suráfrica (15) y Brasil (16).

Al evaluar las 65 muestras analizadas con el método de inmunoensayo enzimático automatizado en el Laboratorio de Salud Pública del departamento del Magdalena presentaron Salmonella spp. únicamente cárnicos: 5 (7.7 %), conformados por 3 de 14 muestras de carne de res (4.6 %) y 2 de 7 muestras de pollo (3.1 %), mientras que esas mismas muestras analizadas por PCR mostraban la presencia de Salmonella spp. en 8 de 14 para un 12.3 % y 4 de 14 para un 6.2 %, respectivamente.

Estos resultados pueden ser explicados por que el método molecular es capaz de detectar células viables y células injuriadas o no cultivables mediante la amplificación de segmentos de su genoma (17), mientras que el método de inmunoensayo enzimático automatizado está basado en la especificidad y afinidad de un anticuerpo monoclonal, por el antígeno somático (O) y antígeno flagelar (H) de microorganismos viables. Otra desventaja del método de inmunoensayo enzimático automatizado (VIDAS SLMTM) consiste en que los resultados positivos para Salmonella son presuntivos y necesitan ser confirmados por aislamiento e identificación en medios no selectivos y posterior siembra en cultivos selectivos según la metodología microbiológica tradicional, debido a que tiene la capacidad de detectar Salmonella spp. en alimentos basándose en la especificidad y afinidad de un anticuerpo monoclonal, por el antígeno somático (O) y antígeno flagelar (H) de este microorganismo.

Con el fin de mejorar los procesos de diagnóstico molecular para detectar Salmonella spp. por la técnica de PCR, o sus variantes, como la PCR múltiple (18, 19, 20) y la PCR en Tiempo Real (qPCR) (21), esta se ha combinado con otros métodos, como la separación inmunomagnética utilizando anticuerpos (22) o sondas fluorescentes (23, 24). Actualmente se ha extendido la implementa-ción de estas tecnologías para el diagnóstico de Salmonella spp. en alimentos, realizando antes de cada ensayo una etapa de enriquecimiento no selectivo de la muestra y una etapa de enriquecimiento selectivo en los medios Rappaport-Vassiliadis, BGA o XLD, que buscan incrementar la confiabilidad de sus resultados (16, 25) y demuestran una alta probabilidad de detectar un bajo número de células. En este estudio se amplificó una banda de 284 pb, que corresponde a un segmento del gen InvA, que está presente en todas las cepas invasivas de Salmonella spp. (13, 26). Previamente se reportó la estandarización de la técnica de PCR para la detección de Salmonella spp. en leche en polvo en un lapso de 12 horas, incluyendo un previo enriquecimiento no selectivo de seis horas antes de cada ensayo, y se encontró un límite de detección de hasta 2 UFC (11).

La cantidad y calidad del ADN extraído es fundamental, pues la mayor dificultad al momento de realizar una PCR es la presencia de compuestos en las muestras que inhiben o afectan la eficiencia de la PCR (27). El 44.6 % de las muestras no mostró presencia de Salmonella spp, lo cual puede ser explicado por la presencia de inhibidores de la PCR en los alimentos, ya que en todos los ensayos se incluyeron los respectivos controles, sin embargo, es necesario realizar estudios para identificar dichos compuestos. La positividad de la PCR depende de muchos factores intrínsecos de su naturaleza, y los resultados numéricos que se obtengan pueden depender de la prevalencia del microorganismo, de la presencia de cepas invasivas de Salmonella spp. en los alimentos estudiados (13) y de las características de las diferentes matrices analizadas.

Este trabajo es realizado por primera vez en la ciudad de Santa Marta, pues en 2006 Espinal et al. realizaron un estudio molecular en el que detectaron la presencia del gen de invA en cepas de Salmonella spp. aisladas de alimentos en diferentes ciudades del Caribe colombiano, sin embargo, Santa Marta no fue incluida en dicho estudio (28).

En conclusión, los resultados muestran que la metodología molecular por PCR ofrece muchas ventajas: una alta sensibilidad y alta especificidad en la detección de Salmonella spp. en alimentos (25), beneficios al sector salud al lograr un diagnóstico rápido y preciso, una buena relación costo-beneficio al sector productivo que le permite la liberación de productos alimenticios al mercado con mayor rapidez y el ahorro de costos; ello justifica la implementación de esta metodología.

La mayor contribución de este estudio fue demostrar que la aplicación de la metodología molecular por PCR acompañada de un breve preenriquecimiento no selectivo es capaz de detectar Salmonella spp. en alimentos, lo cual agiliza notoriamente el tiempo de detección de un microorganismo de importancia en salud pública y sector productivo; asimismo, se propone la aplicación de la metodología molecular por parte de los laboratorios de vigilancia epidemiológica para realizar controles sanitarios en esta región del país.

Agradecimientos: Comité Nacional para el Desarrollo de la Investigación (CONADI), Universidad Cooperativa de Colombia.

Laboratorio de Salud Pública Departamental del Magdalena.

Conflicto de intereses: Ninguno.

Financiación: Universidad Cooperativa de Colombia.


Notas

1Estudiante de medicina, Programa de Medicina Universidad Cooperativa de Colombia sede Santa Marta (Colombia).

2Microbiólogo. Laboratorio de Salud Pública Departamental del Magdalena (Colombia).

3Médico y Cirujano, docente investigador Universidad Cooperativa de Colombia sede Santa Marta (Colombia).

4Microbiólogo, M Sc. Docente investigador. Universidad Cooperativa de Colombia sede Santa Marta (Colombia).


Referencias

(1) Keddy K, Sooka A, Letsoalo M, Hoyland G, Chaignat C, Morrissey A et al. Sensitivity and specificity of typhoid fever rapid antibody tests for laboratory diagnosis at two sub-Saharan African sites. Bull World Health Organ 2011; 89:640 - 7.         [ Links ]

(2) Woo Y. Genetic diversity of multi-resistant Salmonella enterica serotype typhimutium isolates from animals and humans. J Microbiol 2006 Feb; 44:106-12.         [ Links ]

(3) Herikstad H, Mortarjemi Y, Tauxe R. Salmonella surveillance: a global survey of public health serotyping. Epidemiol Infect 2002 Sept; 129: 1-8.         [ Links ]

(4) Philip T, Feldsine, A, Lienau H, Stephanie C. Leung, Linda A. Mui, Florence Humbert, Marylene Bohnert, Kirsten Mooijman et al. Detection of Salmonella in fresh cheese, poultry products, and dried egg products by the ISO 6579 Salmonella Culture Procedure and the AOAC Official Method: Collaborative Study. J AOAC Int 2003 March; 86: 275-95.         [ Links ]

(5) Waage A, Vardund S, Lund T, Kapperud V. Detection of low numbers of Salmonella in enviromental water, sewage and food samples by a nested polymerase chain reaction assay. J Appl Microbiol 1999 Sept; 87: 418-28.         [ Links ]

(6) Fricker C R. The isolation of salmonellas and campylobacters. J Appl Bacteriol 1987 Aug; 63: 99-116.         [ Links ]

(7) McMahon W, Schulte M, Johnson R. Evaluation of VIDAS® Immuno-Concentration Salmonella (ICS)/VIDAS Salmonella (SLM) Immunoassay Method for Detection of Salmonella in Selected Foods (Method Modification 2001.09): Collaborative Study. Journal of AOAC International, 2004 March 1; 87 (2): 390-394.         [ Links ]

(8) Ausubel F, Brent R, Kingston R. Short protocols in molecular biology. United States of America: John Wiley & Sons; 2002. p. 2-11.         [ Links ]

(9) Sambrook J, MacCallum P, Russell D. Purification of nucleic acid. Molecular cloning: A laboratory manual. 3a ed. New York, USA: Col Spring Harbor Laboratory Press; 2001. p. A8.9.         [ Links ]

(10) Rahn K, De Grandis S, Clarke R, McEwen S, Galán J, Ginocchio C. Amplification of an invA gene sequence of Salmonella typhimurium by polymerase chain reaction as a specific method of detection of Salmonella. Mol Cell Probes 1992; 6:271-9.         [ Links ]

(11) Villarreal J, Soto Z, Pereira N, Varela P, Jaramillo R, Mendoza E, Villanueva D. Reacción en cadena de la polimerasa para la detección de Salmonella spp. en leche en polvo: Optimización del método en 12 horas. Salud Uninorte 2008, 24(2): 216-25.         [ Links ]

(12) Feldsine P, Abeyta C, Andrews W. AOAC International Methods Committee Guidelines for validation of qualitative and quantitative food microbiological official methods of analysis. J AOAC Int 2002; 85: 1187- 1200.         [ Links ]

(13) Galán J, Curtiss R III. Distribution of the invA, -B, -C, and -D genes of Salmonella typhimurium among other Salmonella serovar: invA mutants Salmonella typhi are deficient for entry into mammalians. Infect Immun 1991; 59:2901-8.         [ Links ]

(14) Löfström CH, Knutsson R, Engdahl C, Radstrom P. Rapid and Specific Detection of Salmonella spp. in Animal Feed Samples by PCR after Culture Enrichment. App. Environ. Microbiol. 2004; 70: 69-75.         [ Links ]

(15) Moganedi K, Goyvaerts E, Venter S, Sibara M. Optimisation of the PCR-invA primers for the detection of Salmonella in drinking and surface waters following a pre-cultivation step. Water SA 2007; 33: 195-202.         [ Links ]

(16) Ferraz S, Muller M, Macagnan M, Rodenbusch C, Wageck C, Cardoso M. Detection of salmonella sp. from porcine origin: a comparison between a PCR method and standard microbiological techniques. Braz J Microbiol 2005; 36: 373-7.         [ Links ]

(17) Candrian Urs. Polymerase chain reaction in food microbiology. J Microbiol Metho 1995; 23: 89.         [ Links ]

(18) Cardona-Castro N, Sánchez-Jiménez M, Lavalett L, Muñoz N, Moreno J. Development and evaluation of a multiplex polymerase chain reaction assay to identify Salmonella serogroups and serotypes. Diagn Microbiol Infect Dis 2009; 65(3): 327-30.         [ Links ]

(19) Yuan Y, Xu W, Zhai Z, Shi H, Luo Y, Chen Z, Huang K. Universal primer-multiplex PCR approach for simultaneous detection of Escherichia coli, Listeria monocytogenes, and Salmonella spp. in food samples. J Food Sci 2009; 74(8): 446-52.         [ Links ]

(20) Lavalett L, Sánchez M, Muñoz N, Moreno J, Cardona-Castro N. Development and validation of a multiplex polymerase chain reaction for molecular identification of Salmonella enterica serogroups B, C2, D and E. Biomedica 2009; 29(2):244-52.         [ Links ]

(21) Muñoz N, Díaz-Osorio M, Moreno J, Sánchez-Jiménez M, Cardona-Castro N. Development and evaluation of a multiplex realtime polymerase chain reaction procedure to clinically type prevalent Salmonella enterica serovars. J Mol Diagn 2010; 12(2):220-5.         [ Links ]

(22) Jeníková G, Pazlarová J, Demnerová K. Detection of Salmonella in food samples by the combination of immunomagnetic separation and PCR assay. Int Microbiol 2000; 3: 225-29.         [ Links ]

(23) Hagren V, Von Lode P, Syrjálá A, Soukka T, Lóvgren T, Kojola H, Nurmi J. An automated PCR platform with homogeneous timeresolved fluorescence detection and dry chemistry assay kits. Anal Biochem 2008; 374: 411-6.         [ Links ]

(24) Hagren V, von Lode P, Syrjálá A, Korpimáki T, Tuomola M, Kauko O, Nurmi J. An 8hour system for Salmonella detection with immunomagnetic separation and homogeneous time-resolved fluorescence PCR. Int J Food Microbiol 2008; 125: 158-61.         [ Links ]

(25) Schönenbrücher V, Mallinson E, Bülte M. A comparison of standard cultural methods for the detection of foodborne Salmonella species including three new chromogenic plating media. Int J Food Microbiol 2008; 123: 61-6.         [ Links ]

(26) Chiu C, Ou J. Rapid identification of Salmonella serovars in feces by specific detection of virulence genes, InvA and spvC, by an enrichment broth culture-multiplex PCR combination assay. J Clin Microbiol 1996; 34:261922.         [ Links ]

(27) Rossen L, Norskov P. Holmstrom K, Rasmussen Inhibition of PCR by components of food samples, microbial diagnostic assay and DNA-extraction solutions. Int J Food Microbiol 1992; 17: 37-45.         [ Links ]

(28) Espinal P, Prieto E, Otero V, Máttar S. Presencia del gen de invasividad InvA en cepas de Salmonella sp. aisladas de alimentos del Caribe colombiano. Rev Cubana Salud Pública 2006; 32(2): 115-20.         [ Links ]