SciELO - Scientific Electronic Library Online

 
vol.25 issue1Effectiveness of systematic chromoendoscopy for diagnosis of early cancer and gastric premalignant lesions: Results of two consecutive screening campaigns in Colombia (2006-2007)Alpha-fetoprotein and gamma-glutamyltransferase in patients with liver cirrhosis and hepatocellular carcinoma author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista Colombiana de Gastroenterologia

Print version ISSN 0120-9957

Rev Col Gastroenterol vol.25 no.1 Bogotá Jan./Mar. 2010

 

Resistencia de Helicobacter pylori a metronidazol, claritromicina y amoxicilina en pacientes colombianos

Alba Alicia Trespalacios, MSc, Cand PhD (1), William Otero Regino, MD (2), Marcela Mercado Reyes, Bact MSc (3)

(1) Profesora Asociada departamento de Microbiología, Facultad de Ciencias, Coordinadora Especialización en Microbiología Médica Pontificia Universidad, Bogotá, Colombia.

(2) Profesor Asociado de Medicina, Coordinador Unidad de Gastroenterología, Universidad Nacional de Colombia, Gastroenterólogo, Clínica Fundadores, Bogotá, Colombia.

(3) Profesora Asistente Departamento de Microbiología, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá, Colombia.

Fecha recibido: 01-12-09 Fecha aceptado: 02-02-10

Resumen

Helicobacter pylori (H. pylori) es un patógeno universal, que infecta a más de la mitad de la población mundial. En las últimas dos décadas, el tratamiento recomendado para su erradicación, como esquema de primera línea, es la triple terapia estándar, constituida por un inhibidor de la bomba de protones, amoxicilina y claritromicina o metronidazol. En los últimos años la eficacia de esta terapia ha declinado, debido especialmente a la resistencia de la bacteria a metronidazol y a claritromicina.

Objetivos: En este estudio, se evaluó la prevalencia de resistencia primaria de cepas colombianas de H. pylori a metronidazol, claritromicina, amoxicilina. Además, se analizaron los genotipos de vacA y cagA de las cepas aisladas y la correlación entre los marcadores de virulencia y la resistencia a claritromicina, amoxicilina y metronidazol.

Métodos: La resistencia a metronidazol, amoxicilina y claritromicina fue determinada por el método de E-test. Se extrajo el ADN genómico y variantes alélicas de vacA y cagA fueron identificadas por la técnica de reacción en cadena de la polimerasa (PCR).

Resultados: La resistencia a metronidazol fue de 81,01% (IC 95% 70,3%-88,6%), a amoxicilina de 3,8% (IC 95% 0-8,6%) y a claritromicina de 17,72% (IC 95% 10,37-28,29). No se encontró asociación significativa entre el genotipo de patogenicidad y la resistencia o susceptibilidad a los antimicrobianos cuando los valores de CIM de cada antibiótico se compararon con los diferentes genotipos cagA y vacA.

Conclusión: Encontramos una alta tasa de resistencia a los tres principales antibióticos utilizados en la mayoría de los esquemas exitosos de erradicación de la infección, lo cual implica la necesidad de investigar, con prioridad, nuevos esquemas de tratamiento para la erradicación de la infección en Colombia.

Palabras clave

Helicobacter pylori, genotipos, claritromicina, amoxicilina, metronidazol.

Introducción

Helicobacter pylori (H. pylori) es un patógeno universal, que infecta a más de la mitad de la población mundial (1, 2) y es el principal agente etiológico de gastritis crónica, úlceras pépticas, linfoma MALT gástrico y adenocarcinoma gástrico (1-3), aunque las consecuencias finales de la infección dependen de factores genéticos del huésped, factores mediombientales externos y la infección por genotipos más virulentos de H. pylori como cagA (+) y vacA s1m1 (4, 5). En las últimas dos décadas, el tratamiento recomendado para su erradicación como esquema de primera línea es la triple terapia estándar constituida por un inhibidor de la bomba de protones, amoxicilina y claritromicina o metronidazol (6-8). Sin embargo, la eficacia de este esquema tradicional, que inicialmente era del 90% (9-11), de manera progresiva ha disminuido en muchas partes del mundo y llega en la actualidad a cifras de 57-73% cuando la duración es de siete días, y de 67-79% cuando la duración es de diez días (10), lo que significa que la eficacia aumenta aproximadamente 6% cuando el tratamiento dura diez días en comparación con siete días, pero aun así, es menor del 80% y no alcanza resultados óptimos. La declinación en la eficacia consistentemente encontrada en la actualidad, se considera que se debe fundamentalmente al progresivo aumento de la resistencia primaria de H. pylori a la claritromicina y al metronidazol (8-12). Por lo anterior, es importante evaluar la prevalencia de resistencia primaria de H. pylori a estos tres antimicrobianos clave, que son la estructura de la terapia triple estándar ya que todavía se recomienda como la terapia de elección de primera línea (8, 9), pero con la precaución de utilizar antibióticos diferentes cuando la resistencia local a los mismos esté por encima de ciertos valores que comprometerían su eficacia como son, 15-20% para claritromicina y 40% para metronidazol (9). Uno o más de estos antibióticos también se utilizan en la mayoría de los esquemas que son exitosos en la erradicación de H. pylori (9, 10). Por lo tanto, es necesario determinar los niveles de resistencia a los mismos ya que con base en esa información, se podría planear la elección de los antimicrobianos en la práctica clínica (11). En nuestro medio, hace más de una década, un grupo encontró una tasa de resistencia a metronidazol del 82%, utilizando la prueba de E-test (13), la cual puede sobrestimar la tasa de resistencia de H. pylori si se le compara con la técnica de dilución en agar, que es considerada el estándar de oro para determinar la resistencia a metronidazol (14), y además se desconoce la prevalencia de resistencia primaria a claritromicina y a amoxicilina, así como si existe relación entre los diversos genotipos de H. pylori y la resistencia a los antimicrobianos, aspecto que hasta donde investigamos, no ha sido estudiado en nuestro país. De acuerdo a lo anterior, se decidió realizar el presente trabajo, con los siguientes objetivos:

1. Determinar la prevalencia de resistencia primaria de H. pylori a los tres antibióticos considerados los más importantes en las terapias de erradicación: claritromicina, metronidazol y amoxicilina.

2. Establecer si el genotipo de H. pylori cagA y vacA positivos y los diferentes subtipos de este último, se asocian con la resistencia a los diferentes antimicrobianos.

Materiales y métodos

Estudio prospectivo de prevalencia analítica, realizado en la unidad de gastroenterología de la Clínica Fundadores, de Bogotá-Colombia, y el departamento de Microbiología de la Facultad de Ciencias de la Pontificia Universidad Javeriana, de Bogotá-Colombia, durante el periodo comprendido entre enero de 2008 y junio de 2009. Se incluyeron prospectivamente pacientes mayores de 18 años que fueron remitidos a endoscopia digestiva alta en la Clínica Fundadores, por dispepsia o síntomas de reflujo gastroesofágico que no habían recibido tratamientos previos de erradicación de H. pylori como tampoco antibióticos o sales de bismuto durante el último año, o antisecretores, por lo menos un mes antes de la endoscopia realizada para ingresar al presente estudio. Todos los pacientes firmaron el consentimiento informado antes de ingresar al estudio, después de una explicación completa y detallada sobre este. Tanto el protocolo de investigación como el consentimiento informado fueron aprobados por el comité de ética e investigación de la institución en la cual se realizó el estudio.

Criterios de exclusión

Enfermedades concomitantes serias: insuficiencia cardíaca congestiva (ICC), accidente cerebrovascular (ACV), diabetes descompensada, alteraciones de la coagulación, cirrosis, cirugía gástrica previa, embarazadas o que estén lactando, adicción a drogas o alcohol, o enfermedades siquiátricas, infección por VIH, anticoagulados y los que tuvieran cáncer o recibieran quimioterapia.

A todos los pacientes, la endoscopia digestiva se les realizó por la mañana, después de un ayuno mínimo de seis horas, en decúbito lateral izquierdo, en la forma usual (15) y siguiendo las recomendaciones generales para la limpieza de los endoscopios (15). No se utilizó sedación y a todos se les aplicó lidocaína en atomizador (Roxicaína, solución tópica, Ropsohn Therapeutics) utilizando dos aplicaciones (20 mg), para anestesiar la faringe. El equipo utilizado para la EVDA fue un Olympus Exera CV 145. Durante la endoscopia digestiva alta, se tomaron seis biopsias del antro a dos centímetros del píloro (tres de la curvatura mayor y tres de la curvatura menor) y seis biopsias del cuerpo a ocho centímetros del cardias (tres de la curvatura menor y tres de la curvatura mayor), siguiendo el protocolo de toma de biopsias recomendado por expertos (16, 17). De estos grupos de biopsias, dos del antro y dos del cuerpo fueron utilizadas para estudio de histología y determinación de H. pylori mediante hematoxilina y eosina (HE) y coloración de Giemsa (cuando la HE fue negativa) y dos del antro y dos del cuerpo para cultivo de H. pylori. Dos biopsias del antro y dos biopsias del cuerpo fueron guardadas con la intención de ser utilizadas para nuevo cultivo, en caso de que sucediera alguna dificultad con las primeras (contaminación del medio de cultivo, mala calidad de sus ingredientes en algún lote, etc.). Se tomó una biopsia adicional del antro para la prueba de ureasa rápida y más biopsias si existieran lesiones endoscópicas que lo justificaran (úlceras gástricas, masas, elevaciones, tumores, etc.). La prueba de ureasa rápida utilizada fue preparada por nosotros ("homemade"), de acuerdo a las recomendaciones para la misma (18). En un formulario específicamente diseñado, se consignaron de manera prospectiva y estandarizada las variables demográficas y las demás variables incluidas en el estudio.

Cultivo de H. pylori y pruebas de susceptibilidad de antibióticos in vitro

Procedimiento de transporte: Cada biopsia tomada durante la endoscopia digestiva alta se depositó en un criovial con 500 µl de caldo Brucella y estos se mantuvieron en cadena de frío hasta su procesamiento.

Procedimiento de aislamiento de Helicobacter pylori: En total asepsia y esterilidad, las biopsias se maceraron con un aplicador de madera estéril, previamente tratado en una solución de carbón activado al 1%, hasta obtener una solución homogénea (19). Luego se procedió a sembrar con asa curva desechable la solución anterior en el medio Wilkins Chalgren modificado para H. pylori suplementado con Isovitalex y antibióticos. Una vez realizada la siembra, las cajas de Petri se introdujeron en campanas de anaerobiosis y se generó una atmósfera de microaerofilia con sobres CampyPak (BBL- Beckton-Dikinson) y los cultivos se incubaron a 37 grados centígrados durante 4-15 días (19, 20).

Pruebas de identificación para Helicobacter pylori: Para verificar la presencia de Helicobacter pylori en los cultivos, se realizaron las siguientes pruebas (20): coloración de gram: bacilos gram negativos curvos pequeños; prueba de catalasa: catalasa positiva; oxidasa: oxidasa positiva; ureasa: ureasa positiva.

Después de confirmadas por pruebas bioquímicas, se procedió a la evaluación de susceptibilidad a metronidazol, amoxicilina y claritromicina. Adicionalmente, a 60 de los 79 aislamientos se les realizó extracción del DNA y amplificación de los genes de virulencia vacA y cagA por la técnica de PCR (19).

Genotipificación del gen cagA por PCR (19, 21, 22)

Para la genotipificación del gen cagA se obtuvieron productos de amplificación del DNA por PCR en un volumen final de 25 µl, para lo cual se dispensaron: 0,1 µl de Taq polimerasa (TucanTaq-Corpogen), 2,5 µlde buffer Taq (TucanTaq-Corpogen), 1,5 µl de MgCl2 (TucanTaq-Corpogen), 0,5 µl de dNTPs mix (Invitrogen), 1 µl de cada primer de cagA Forward y Reverse (IDT-Coralville-USA), 5 µl de solución de DNA a una concentración de 100 ng y se completó con agua grado molecular para completar al volumen final de 25 µl. Las secuencias de los primers de cagA fueron:

cagA F(+) 5’- TTGACCAACAACCACAAACCGAAG - 3’

cagA R(-) 5’- CTTCCCTTAATTGCGAGATTCC - 3’

Posiciones de acuerdo al ORF cagA en Genbank secuencia L11714.

La amplificación de cagA se realizó en un termociclador (MyCycler termal cycler-BIORAD), de la siguiente manera:

1. Denaturación inicial 9 min a 94°C.

2. Cuarenta ciclos de denaturación 95°C por 30 segundos, hibridación 50°C por 45 segundos y extensión 72°C por 45 segundos.

3. Extensión final: 72°C por 5 minutos.

Después, los amplificados se corrieron en geles de agarosa al 2%, y se revelaron en solución de bromuro de etidio.

Genotipificación del gen vacA por PCR (19, 21, 22)

Para la genotipificación del gen vacA se obtuvieron productos de amplificación del DNA por PCR (19, 21) en un volumen final de 25 µl, para lo cual se dispensaron: 0,1 µl de Taq polimerasa (TucanTaq-Corpogen), 2,5 µl de buffer Taq (TucanTaq-Corpogen), 1,5 µlde MgCl2 (TucanTaq-Corpogen), 0,5 µl de dNTPs mix (Invitrogen), 1 µl de cada primer vacA s1/s2, vacA s1a, vacA s1b, vacA m1 y vacA m2 (tabla 1). (F y R) (IDT-Coralville USA), 5 µl de solución de DNA a una concentración de 100 ng y se completó con agua grado molecular para completar al volumen final de 25 µl.

La amplificación de vacA se realizó en un termociclador (MyCycler termal cycler-BIORAD), de la siguiente manera:

1. Treinta y cinco ciclos de denaturación 94°C por 1 minuto, hibridación 52°C por 1 minuto y extensión 72°C por 1 minuto.

2. Extensión final: 72°C por 5 minutos.

Los diferentes genotipos de H. pylori se agruparon en dos grupos, "grupo más virulento" y "grupo menos virulento" (19). El primero estaba integrado por aquellos que eran cagA(+) y vacA(+) con subtipos s1am1+ y el segundo grupo cagA(-) vacA(+) pero con subtipos s2m2 (+). La secuencia de los primers utilizados se indica en la tabla 1.

Tabla 1. Secuencia de los primers utilizados.

Determinación la concentración mínima inhibitoria (CMI)

Técnica de E-test (23-25)

A partir de cultivos de 2 a 3 días de incubación, se preparó una suspensión en caldo Brucella que se ajustó a la escala 2 de MacFarland (1 x 108 UFC/ml), la suspensión se inoculó con un escobillón estéril sobre placas de agar Mueller-Hinton suplementado con 10% de suero de caballo, 2% de isovitalex. Se utilizó una caja con medio de cultivo por cada antibiótico (metronidazol, claritromicina, amoxicilina) a ensayar.

Las tiras de E-Test® (Biomeriux) se colocaron sobre las placas de medio de cultivo inoculadas con la bacteria y se incubaron a 37°C en condiciones de microaerofilia por 48-72 horas. Los aislamientos fueron considerados resistentes si la concentración mínima inhibitoria (CMI) se encontraba en niveles iguales o superiores a 8 µg/ml para metronidazol; 0,5 µg/ml para claritromicina y 1 µg/ml para amoxicilina (23). Para controlar medios de cultivo y tiras de E-Test, se utilizó la cepa control, H. pylori NCTC 11637 (24, 25).

Análisis estadístico

Con los datos obtenidos se elaboró una base datos en el programa EPIINFO versión 6.0. Los resultados obtenidos fueron procesados y analizados estadísticamente utilizando el programa STATA versión 6.0. Se determinó el porcentaje de resistencia a claritromicina, amoxicilina y metronidazol, así como el porcentaje de presencia del gen cagA y los diferentes alelos para el gen vacA, en los aislamientos analizados. Se buscó asociación entre la presencia de los genes de virulencia y la resistencia a los antibióticos, la cual fue evaluada mediante una prueba de ji cuadrado (X2), con un valor alfa (α) de 0,05.

Resultados

Se lograron 79 aislamientos de H. pylori de 99 muestras enviadas de igual número de pacientes, en quienes se documentó el diagnóstico de H. pylori con base en el test de ureasa rápida positivo e identificación de H. pylori en la histología, representando una tasa de recuperación del 80%. El 67% de los pacientes en quienes se recuperó el microorganismo eran mujeres. La edad promedio de la muestra total era 54 años +/-15 años. El diagnóstico endoscópico fue esofagitis erosiva en 16 pacientes (25%), gastritis crónica corporoantral en 79 (100%), y úlcera duodenal en 4 (5%).

Las prevalencias de las resistencias, utilizando E-test, fueron las siguientes: metronidazol 81,01% (IC 95% 70,31-88,64), claritromicina 17,72% (IC 95% 10,37-28,29%), y amoxicilina 3,8% (IC 95% 0-8,6%), (tabla 2). No hubo diferencias estadísticamente significativas en las tasas de resistencia para los tres antibióticos entre hombres y mujeres.

Tabla 2. Prevalencias de resistencias a los diferentes antibióticos.

El 25% de los genotipos identificados fueron del grupo "más virulentos", como se ve en la tabla 4, en la cual se muestran, además, las frecuencias relativas de los demás genotipos de H. pylori en los 60 pacientes examinados. No se encontraron diferencias estadísticamente significativas entre el genotipo cagA vacA s1am1 y los demás genotipos con la resistencia a los antibióticos claritromicina, amoxicilina y metronidazol: p=0,36, p=0,36 y p=1, respectivamente tablas 3 y 4.

Tabla 3. Proporción de resistencia a claritromicina, amoxicilina y metronidazol en genotipos de H. pylori.

Tabla 4. Evaluación de la relación de resistencia a claritromicina, amoxicilina y metronidazol frente a diferentes genotipos de virulencia de H. pylori.

Discusión

Actualmente, para los gastroenterólogos y médicos de cuidado primario, la erradicación de H. pylori es un gran desafío ya que cada día está aumentando la resistencia primaria de este microorganismo a los antibióticos más frecuentemente utilizados en su tratamiento (8-12, 26, 27), la cual se debe en parte a la exposición de la población a esos antibióticos como monoterapia para diversas enfermedades infecciosas (11, 12). En el reciente tercer consenso de Maastricht (9) se recomendó continuar utilizando la triple terapia estándar durante siete días en las poblaciones con resistencia a la claritromicina menor al 15-20% y, cuando es mayor al 20%, prolongarla a 14 días o utilizar una terapia cuádruple con bismuto durante 10 a 14 días. Así mismo, recomendó utilizar el metronidazol en la triple terapia cuando la resistencia es menor del 40%. En la presente investigación se encontró que la resistencia primaria a metronidazol fue del 81,01% y a claritromicina del 17,72% las cuales están dentro de los límites sugeridos para no ser utilizado en la triple terapia como esquema de primera línea (9).

El resultado de resistencia a metronidazol encontrada por nosotros concuerda con los resultados de investigaciones de otros países en vías de desarrollo (28, 29), y con otros trabajos de Colombia que utilizaron la misma metodología con E-test (13, 30). Gutiérrez y col (13), en 1998, encontraron resistencia a metronidazol en el 82% y, recientemente, Henao y col, 72% (30). El alto nivel de resistencia encontrado en el presente trabajo contrasta con la encontrada globalmente en países europeos que es del 33% (31), Estados Unidos 39% (32), Australia 32% y Japón 4% (33). Aunque la técnica de E-test, puede exagerar la verdadera resistencia a metronidazol, si se le compara con la técnica de dilución agar (14), la diferencia estimada entre ambos métodos se ha encontrado que puede ser del 10-20% (12), por lo cual consideramos que ante tasas tan altas de resistencia al metronidazol, el valor predictivo de los resultados del E-test finalmente dará resultados que están por encima del 40% que es el límite máximo considerado por los expertos para que se utilice este medicamento (9). La prevalencia de resistencia a metronidazol fue similar en hombres y mujeres (79,5% y 82,7% respectivamente).

La resistencia a claritromicina del 17,7% es similar al 15% publicado este año por Henao y col (34) y contrasta marcadamente con el 3,8% encontrada por otros investigadores del centro occidente de Colombia (35). Es posible que la discrepancia con los hallazgos de este último trabajo se relacione con el nivel socioeconómico de la población estudiada por ellos, la cual, como comentan los autores, probablemente tendría menos exposición a este antimicrobiano por no estar en el plan obligatorio de salud de Colombia, aunque hasta el momento, se ha considerado que la resistencia a este antimicrobiano tiene relación fundamentalmente con la utilización previa de macrólidos para infecciones respiratorias (12). De igual manera, nuestros hallazgos divergen con los encontrados en el norte de Europa y Escandinavia que tienen prevalencias de 4% (12) y 1-3% (36) respectivamente y son superiores a los de Estados Unidos en donde es del 12,9% (37). La prevalencia global de resistencia en Europa a claritromicina es del 10% y en el sureste de ese continente es del 18% (12), la cual coincide con nuestros resultados.

El impacto de la resistencia a metronidazol y a claritromicina es trascendental en la infección por H. pylori. La resistencia a metronidazol reduce la eficacia en 50% de las terapias triples y cuádruples (27) y cuando hay resistencia a claritromicina en 37% (38) a 70% (12). En Francia, se ha encontrado que cuando la cepa es sensible a claritromicina, la tasa de erradicación es del 87,8% y desciende a 18,3% si hay resistencia al mismo (12). En las recomendaciones de Maastricht (9), cuando hay resistencia aislada a claritromicina mayor a 15% y a metronidazol menor a 40%, se continúa sugiriendo como terapia de primera línea, una triple terapia con claritromicina-metronidazol durante 14 días o una terapia cuádruple. Sin embargo, no hay recomendaciones para las áreas geográficas en que existan simultáneamente altas tasas de resistencia para ambos antibióticos como las encontradas en esta investigación, lo cual implica que en nuestro medio es urgentemente necesario investigar terapias bien toleradas que superen las resistencias a estos dos medicamentos. Una estrategia podría ser la terapia secuencial clásica de 10 días con inhibidor de bomba de protones con amoxicilina los primeros cinco días y claritromicina más tinidazol durante los últimos cinco días en reemplazo de amoxicilina, la cual no disminuye sustancialmente su eficacia cuando hay resistencia a claritromicina pero pierde toda su eficacia cuando hay resistencia dual a claritromicina y a metronidazol como fue recientemente demostrado en uno de los más importantes trabajos publicados al respecto (39). En el presente trabajo no se encontraron resistencias simultáneas en una misma cepa; sin embargo, las altas tasas de resistencia a metronidazol y a claritromicina hacen plantear la duda sobre la utilidad de esta terapia secuencial y debe ser un estímulo para investigarla de manera prioritaria en nuestro medio. Con base en nuestros resultados, otra alternativa sería utilizar triples terapias que contengan levofloxacina, las cuales han demostrado eficacia tanto en terapias de primera línea (40-42) como en terapias de rescate de segunda (43-46) y tercera línea (47).

Con respecto a la resistencia a la amoxicilina, mundialmente se han encontrado que es inferior al 2% y por lo tanto hasta el momento no se le considera un problema para la erradicación de H. pylori (10, 12), por lo cual, el 3.8% encontrado en este estudio, es un hallazgo sorprendente, que implica una dificultad adicional para el manejo de H. pylori en nuestro medio. Hasta el momento, los países con las más altas tasas de resistencia a este antimicrobiano eran Kenia con 4,6% (48) y Bangladesh con 6,6% (49).

No encontramos asociación entre los genotipos de H. pylori y la resistencia a los tres antibióticos investigados, lo que coincide con investigaciones realizadas en otras latitudes con el mismo fin (50-53). Sin embargo, es diferente a los hallazgos de investigadores irlandeses, quienes encontraron que la tasa de resistencia a metronidazol es más alta en cepas cagA(+)vacAs1m1 (54).

Teniendo en cuenta los resultados de esta investigación que encontró altas tasas de resistencia para los tres antibióticos más importantes para erradicar H. pylori, sería cuestionable la utilidad de la terapia triple estándar como esquema de primera línea en nuestro medio, si bien la única forma de confirmar esta presunción sería realizando un ensayo clínico. Aunque se requieren estudios adicionales, ojalá multicéntricos, para confirmar y ampliar los resultados de este estudio, consideramos que la información derivada del mismo puede ser de utilidad para los médicos involucrados en el tratamiento de H. pylori, para planear qué esquema antibiótico utilizar como terapia empírica. Los expertos consideran que al igual que en otras enfermedades infecciosas transmisibles para el tratamiento de H. pylori es fundamental disponer de la información sobre los niveles de resistencia del microorganismo a los antibióticos usualmente utilizados con el fin de elegir esquemas eficaces (10-12) y, en ese sentido, este trabajo ha develado unos datos preocupantes.

En conclusión, se ha encontrado una alta tasa de resistencia a los tres principales antibióticos utilizados en la mayoría de los esquemas exitosos de erradicación de la infección. Esta información tiene un gran impacto para nuestro país y por lo tanto implicaría que es necesario investigar de manera preferencial diferentes terapias de erradicación de H. pylori.

Conflicto de intereses

El presente trabajo fue financiado por Colciencias, como parte del proyecto "Erradicación de Helicobacter pylori: triple terapia con levofloxacina". Código 1203-408-20464.

Referencias

1. Malaty HM. Epidemiology of Helicobacter pylori. Best Pract Res Clin Gastroenterol 2007; 21: 205-14.        [ Links ]

2. Suebaum S, Michetti P. Helicobacter pylori infection. N Engl J Med 2002; 347: 1175-86.         [ Links ]

3. Current European Concepts in the management of Helicobacter pylori infection. The Maastricht Consensus Report. European Helicobacter pylori Study Group. Gut 1997; 41: 8-13.        [ Links ]

4. Guillen D, McColl KEL. Gastroduodenal disease, Helicobacter pylori, and genetic polymorphisms. Clinical Gastroenterol Hepatol 2005; 3: 1180-86.         [ Links ]

5. Argent RH, Kidd M, Owen RJ, Thomas RJ, Limb MC, Atherton JC. Determinants and consequences of different levels of Cag A phosforilation for clinical isolates of Helicobacter pylori. Gastroenterology 2004; 127: 514-23.        [ Links ]

6. Howden CW, Hunt RH. Guidelines for the management of Helicobacter pylori. Ad Hoc Committee on practice parameters of the American College of Gastroenterology. Am J Gastroenterol 1998; 93: 2330-8.        [ Links ]

7. Bytzer P, O´Morain C. Treatment of Helicobacter pylori Helicobacter 2005; 10(Suppl 1): 40-46.        [ Links ]

8. Chey WD, Wong BCY. American College of Gastroenterology Guideline on the Management of Helicobacter pylori Infection. Am J Gastroenterol 2007; 102: 1808-25.        [ Links ]

9. Malfertheiner P, Megraud F, O´Morain C, Bazzoli F, El-Omar E, Graham D, et al. Current concepts in the management of Helicobacter pylori infection- The Maastricht III consensus report. Gut 2007; 56: 772-81.        [ Links ]

10. Vakil N, Megraud F. Eradication therapy for Helicobacter pylori. Gastroenterology 2007; 133: 985-100.        [ Links ]

11. Graham DY, Shiotani A. New concepts of resistence in the treatment of Helicobacter pylori infections. Nature Clin Pract Gastroenterol Hepatol 2008; 5: 321-31.        [ Links ]

12. Megraud F. Helicobacter pylori antibiotic resistance: prevalence, importance and advances in testing. Gut 2004; 53: 137-84        [ Links ]

13. Gutiérrez O, Otero W. Resistencia de Helicobacter pylori al Metronidazol en Colombia. Rev Col Gastroenterol 1998; 12: 31-5.        [ Links ]

14. Clinical and laboratory Standards Institute. Methods for antimicrobial dilution and disk susceptibility testing for infrequently isolated or fastidious bacteria 2006(5):M2-M7. Pen. USA.        [ Links ]

15. Cotton PB, Williams CB. Practical Gastrointestinal endoscopy: The fundamentals (5th edition), Oxford: Blackwell Publishing Ltd. 2003.        [ Links ]

16. El-Zimaity HM, Graham DY. Evaluation of gastric mucosal biopsy site and number for identification of Helicobacter pylori or intestinal metaplasia: role of the Sydney system. Hum Pathol 1999; 30: 72-7.        [ Links ]

17. Guamer J, Herrera-Goepfert R, Mohar A, Smith C, Schofield A, Halperin D, et al. Diagnostic yield of gastric biopsy specimens when screening for preneoplastic lesions. Hum Pathol 2003; 34: 28-35.        [ Links ]

18. Genta RM, Graham DY. Diagnosis and treatment of Helicobacter pylori. En Graham DY, Genta RM, Dixon MF. Gastritis. Lippincott Williams &Wilkins Phil 1999. p. 189-201.        [ Links ]

19. Quiroga AJ, Cittelly DM, María Bravo MM. Frecuencia de los genotipos babA2, oipA y cagE de Helicobacter pylori en pacientes colombianos con enfermedades gastroduodenales. Biomédica 2005; 25: 325-34.        [ Links ]

20. Ansorg R, Von Recklinghausen G, Pomarius R, Schmid EN. Evaluation of Techniques for Isolation, subcultivation, and Preservation of Helicobacter pylori. J Clin Microbiol 1991; 29(1): 51-53.        [ Links ]

21. Cittelly DM, Huertas MG, Martínez JD, Oliveros R, Posso H, Bravo MM, et al. Helicobacter pylori genotypes in non atrophic gastritis are different of the found in peptic ulcer, premalignant lesions and gastric cancer in Colombia. Rev Med Chile 2002; 130: 143-51.        [ Links ]

22. Martínez A, González C, Kawauchi F, Montoya F. Helicobacter pylori: análisis de cagA y genotipificación de vacA en Chile. Detección de una cepa s2/m1. Rev Med Chile 2001; 129: 1147-1153.        [ Links ]

23. Osato MS. Antimicrobial Susceptibility Testing for Helicobacter pylori: Sensitivity Test Results and Their Clinical Relevance. Curr Pharm Des 2000; 6: 1545-1555.         [ Links ]

24. Glupczynski Y, Labbe M, Hansen W, Krocaert F, Yourassowsky E. Evaluation of the E Test for Quantitative Antimicrobial Susceptibility Testing of Helicobacter pylori. J Clinical Microbiol 1991; 29: 2072-2075.        [ Links ]

25. Osato MS, Reddy R, Reddy SG, Penland RL, Graham DY. Comparison of the Etest and the NCCLS-approved agar dilution method to detect metronidazole and clarithromycin resistant Helicobacter pylori. Int J Antimicr 2001; 17: 39-44.        [ Links ]

26. Blaser MJ, Atherton JC. Helicobacter pylori persistent: biology and disease. J Clin Invest 2004; 113: 321-33.        [ Links ]

27. Houben MHM, van de Beck D, Hensen EF, De Craen AJM, Waws EAJ, Tytgat GNJ. A systematic review of Helicobacter eradication therapy-the impact of antimicrobial resistance on eradication rates. Aliment Pharmacol Ther 1999; 13: 1047-55.        [ Links ]

28. Datta S, Chattopadhyay S, Patra R, Ramamurthy R de T, Hembram J, Chowdhury S, et al. Most Helicobacter pylori strains of Kolkata in India are resistant to metronidazole but susceptible to other drugs commonly used for eradication and ulcer therapy. Aliment Pharmacol Ther 2005; 22: 51-7.        [ Links ]

29. Torres J, Camorlinga-Ponce M, Perez-Pérez G, Madrazo De la Garza A, Dahesa M, González-Valencia G, et al. Increasing multidrug resistance in Helicobacter pylori strains isolated from children and adults in Mexico. J Clin Microbiol 2001; 39: 2677-80.        [ Links ]

30. Henao SC, Otero W, Ángel LA, Martínez JD. Resistencia primaria a Metronidazol en aislamientos de Helicobacter pylori en pacientes adultos de Bogotá. Rev Col Gastroenterol 2009; 24: 10-15.        [ Links ]

31. Glupzynski Y, Mégraud F, López Brea M. European multicenter survey of in vitro antimicrobial resistance in Helicobacter pylori. Eur J Clin Microbial Infect Dis 2000; 11: 820-3.        [ Links ]

32. Osato MS, Reddy R, Reddy SG, Penland RL, Malaty HM, Graham DY. Pattern of primary resistance of Helicobacter pylori to metronidazole or claritrhomycin in the United States. Arch Intern med 2001; 161: 1217-20.        [ Links ]

33. Mégraud F. Helicobacter pylori resistance to antibiotics: prevalence, mechanism, detection. What’s new? Can J Gastroenterol 2003; 17(Suppl. B): 49B-52B.        [ Links ]

34. Henao SC, Quiroga A, Martínez JD, Otero W. Resistencia primaria a la claritromicina en aislamientos de Helicobacter pylori. Rev Col Gastroenterol 2009; 24: 110-114.        [ Links ]

35. Alvarez A, Moncayo JI, Santaccruz JJ, Santacoloma M, Corredor LF, Reinosa E. Antimicrobial susceptibility and mutations invlved in clarithromycin resistance in Helicobacter pylori isolates from patients in the western central region of Colombia. Antimicr Ag Chemother 2009; 53: 40222-4.        [ Links ]

36. Vakil N. H. pylori treatment: new wine in old bottles? Am J Gastroenterol 2009; 104: 26-30.        [ Links ]

37. Duck WM, Sobel J, Prukler JM, et al. Antimicrobial resistance incidence and risk factors among Helicobacter pylori-infected persons. United states Emerg Infect Dis 2004; 10:1088-94.        [ Links ]

38. Jefri NS, Hornung CA, Howden CW. Meta-analysis: sequential therapy appears superior to standard therapy for Helicobacter pylori infection in naive patients. Ann Intern Med 2008; 148: 923-31.        [ Links ]

39. Vaira D, Zulo A, Vakil N, Gatta L, Ricci C, Perna F, et al. Sequential therapy versus standard triple drug therapy for Helicobacter pylori eradication. Ann Intern Med 2007; 146: 556-63.        [ Links ]

40. Gisbert JP, Fernández M, Molina J, Pérez A, Prieto B, Matos JM, et al. First line triple therapy with levofloxacin for Helicobacter pylori eradication. Alimen Pharmacol Ther 2007; 26: 495-500.        [ Links ]

41. Nista EC, Candelli M, Zocco MA, Cremonini F, Ojeti M, Finizio R, et al. Levofloxacin-based triple therapy in first line treatment for Helicobacter pylori eradication. Am J Gastroenterol 2006; 101: 1985-90.        [ Links ]

42. Schrauwen RWM, Jannssen MJR, de Boer WA. Seven-day PPI triple therapy with levofloxacin is very effective for Helicobacter pylori infection. J Med 2009; 67: 96-101.        [ Links ]

43. Cheng HC, Chang WL, Chen WY, Yang HB, WU JJ, Sheu BS. Levofloxacin–containing triple therapy to eradicate the persistent H. pylori after a failed conventional triple therapy. Helicobacter 2007; 12: 359-63.        [ Links ]

44. Perna F, Zullo A, Ricci C, Hassan C, Morini S, Vaira D. Levofloxacin –based triple therapy for Helicobacter pylori re-treatment: role of bacterial resistance. Dig Liv Dis 2007; 39: 1001-5.        [ Links ]

45. Gisbert JP, Bermejo F, Castro M, Aisa A, Fernández M, Tomas A, et al. Second Line therapy with levofloxacin after H. pylori treatment failure: a Spanish multicenter study of 300 patients. Am J gastroenterol 2008; 103: 71-6.        [ Links ]

46. Di Caro S, Franceschi F, Mariani A, Thompson F, Raimondo D, Masci E, Testoni A, et al. Second line levofloxacin based triple schemes for Helicobacter pylori eradication. Dig Liv Dis 2009;41:480-85        [ Links ]

47. Gisbert JP, Castro M, Bermejo F, Pérez A, Ducons J, Fernández M, Bory F, et al. Third line rescue therapy with levofloxacin after two H. pylori treatment failures. Am J Gastroenterol 2006; 101: 243-7.        [ Links ]

48. Lwal-Lume L, Ogutu EO, Amayo EO, et al. Drug susceptibility pattern of Helicobacter pylori in patients with dyspepsia in Kenyatta National Hospital Nairobi. East Afr Med J 2005; 82: 603-8.        [ Links ]

49. Nahar S, Mukhopadhay AK, Khan R, et al. Antimicrobial susceptibility of Helicobacter pylori strains isolated in Bangladesh. J Clin Microbiol 2004; 42: 4856-58.        [ Links ]

50. Godoy AP, Ribeiro ML, Benvengo YH, Vitiello L, Miranda M de C, et al. Analysis of antimicrobial susceptibility and virulence factors in Helicobacter pylori clinical isolates. BMC Gastroenterol 2003; 11(3): 20.        [ Links ]

51. Debets-Ossenkopp YJ, Reyes G, Mulder J, Aan de Stegge BM, Peters JT, Savelkoul PH, Tanca J, Pena AS, Vandenbroucke-Grauls CM. Characteristics of clinical Helicobacter pylori strains from Ecuador. J Antimicrob Chemother 2003; 51: 141-145.        [ Links ]

52. López-Brea M, Martínez MJ, Domingo D, Sánchez I, Alarcón T. Metronidazole resistance and virulence factors in Helicobacter pylori as markers for treatment failure in a paediatric population. FEMS Immunol Med Microbiol 1999; 24: 183-8.        [ Links ]

53. Zschausch HC, Han SR, Meyer HG, Maeurer MJ. No association between Helicobacter pylori genotypes and antibiotic resistance phenotypes within families. Helicobacter 2002; 7: 364-6.        [ Links ]

54. Taneike I, Nami A, O’Connor A, Fitzgerald N, Purphy P, Oasim A, et al. The analysis of drug resistance and virulent-factor genotype of Irish Helicobacter pylori strains: is there any relationship between to metronidazole and cagA status? Aliment Pharmacol Ther 2009; Jul 9 (Epub ahead of print).        [ Links ]

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License