SciELO - Scientific Electronic Library Online

 
vol.25 issue1Proton pump inhibitors and clopidogrel: Evidence of a Pharmacological interaction of great clinical impactBiliary fistula and Bouveret’s Syndrome. The same but different author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Revista Colombiana de Gastroenterologia

Print version ISSN 0120-9957

Rev Col Gastroenterol vol.25 no.1 Bogotá Jan./Mar. 2010

 

Infección oculta por el virus de la hepatitis C en un paciente retrasplantado por falla hepática de origen desconocido

Fabián M Cortés-Mancera (1), Juan Carlos Restrepo (2), Germán Osorio (3), Sergio Hoyos (4), Gonzalo Correa (5), María Cristina Navas (6)

(1) Bacteriólogo y Laboratorista Clínico. Magíster en Ciencias Básicas Biomédicas. Integrante Grupo de Gastrohepatología, Universidad de Antioquia. Docente Ing. Biomédica, Instituto Tecnológico Metropolitano de Medellín. Medellín, Colombia.

(2) Médico General, Especialista en Medicina interna, subespecialista en hepatología clínica y trasplante de hígado. Magíster en Trasplante de órganos y tejidos. Doctor en biopatología. Integrante Grupo de Gastrohepatología, Universidad de Antioquia. Médico Internista del Grupo de Hepatología y trasplante de hígado del Hospital Pablo Tobón Uribe. Docente Facultad de Medicina Universidad de Antioquia. Medellín, Colombia.

(3) Médico Cirujano, Patólogo. Universidad de Antioquia. Jefe del Departamento de Patología del Hospital San Vicente de Paúl. Docente Facultad Medicina Universidad de Antioquia. Integrante Grupo de Gastrohepatología. Medellín, Colombia.

(4) Médico Cirujano, Especialista en Cirugía hepatobiliar. Integrante Grupo de Gastrohepatología, Universidad de Antioquia. Integrante Grupo de Hepatología y trasplante de hígado del Hospital Pablo Tobón Uribe. Docente Facultad de Medicina Universidad de Antioquia. Medellín, Colombia.

(5) Médico Cirujano, Especialista en Medicina interna, subespecialista en hepatología clínica y trasplante de hígado. Integrante Grupo de Gastrohepatología, Universidad de Antioquia. Médico Internista del Grupo de Hepatología y trasplante de hígado del Hospital Pablo Tobón Uribe. Docente Facultad de Medicina Universidad de Antioquia. Medellín, Colombia.

(6) Bacterióloga y laboratorista clínico, Magíster en Microbiología. Doctor en Virología. Directora Grupo de Gastrohepatología, Universidad de Antioquia. Directora Corporación de posgrados en Ciencias Básicas Biomédicas, Universidad de Antioquia. Docente Facultad de Medicina, Universidad de Antioquia. Medellín, Colombia.

Fecha recibido: 01-12-09 Fecha aceptado: 02-02-10

Resumen

Recientemente, se ha descrito un nuevo escenario clínico denominado hepatitis C oculta (HCV-Oc); este solo puede ser caracterizado mediante análisis del genoma viral, ya que marcadores serológicos por prueba de ELISA no son detectables.

En este trabajo se pretendió identificar el virus de la hepatitis C (HCV) en un paciente retrasplantado por falla hepática de origen desconocido. Para esto, ARN obtenido de los explantes, muestras de suero, plasma y buffy coat, fue analizado mediante una RT-PCR que amplifica la región 5’UTR del HCV, demostrando la presencia del genoma viral solo en el tejido hepático de ambos explantes; al analizar las secuencias, los aislados fueron caracterizados como genotipo 1a.

Este estudio obedece al primer reporte en el mundo de HCV-Oc causada por el genotipo 1a del HCV, en un paciente que debió ser trasplantado. Se recomienda tener en cuenta este nuevo escenario para el diagnóstico diferencial en cirrosis hepática, carcinoma hepatocelular y/o falla hepática de origen desconocido.

Palabras clave

Falla hepática, hepatitis C oculta, genotipo, RT-PCR.

Introducción

La infección por el virus de la hepatitis C (HCV) es uno de los problemas de salud pública de mayor impacto debido a su amplia distribución y su relación con el desarrollo de cirrosis y carcinoma hepatocelular (HCC); se estima que a nivel mundial existen más de 170 millones de individuos infectados (1).

El HCV pertenece a la familia Flaviviridae, género hepacivirus (2, 3). Este posee un genoma ARN de cadena sencilla con polaridad positiva, de aproximadamente 9600 nucleótidos de longitudes que contienen un marco de lectura abierto, flanqueado por regiones no codificante (denominadas 5´ y 3´UTR, por las siglas en inglés Untranslated Region). De estas, la región 5’UTR posee una estructura secundaria que contiene un sitio de entrada interna al ribosoma (IRES), esencial para la traducción cap-independiente del RNA viral (4), función que explica el grado de conservación de este segmento genómico entre los diferentes aislados y su utilización para el diagnóstico molecular de la infección (5).

Hasta la fecha, 6 genotipos y más de 100 subtipos han sido descritos para el HCV, con una divergencia del 35 y 15-20%, respectivamente (6). El genotipo se indica por números arábigos y una letra minúscula para indicar el subtipo (Robertson B, 1998); el genoma total, Core, NS5b y la región 5’UTR son utilizados de manera rutinaria para la genotipificación de asilados del HCV (7, 8). Los genotipos del HCV presentan una circulación geográfica más o menos específica. Los genotipos 1, 2, y 3 tienen una distribución mundial, su predominio varía de un área geográfica a otra. Los subtipos 1a y 1b son los más comunes en los Estados Unidos de América (9) y en Europa (10). En Japón, subtipo 1b es responsable del 73% de los casos de infección por el virus de la hepatitis C (11), mientras que en Latinoamérica y Colombia el genotipo 1 se ha descrito como el de mayor prevalencia (12-15). Por otra parte, la infección por ciertos genotipos del HCV tiene implicaciones clínicas importantes. Por ejemplo, el genotipo 1b está asociado con un marcado deterioro hepático (16), mientras que los genotipos 1 y 4 se asocian con menos respuesta al tratamiento antiviral (17-19).

La infección crónica por HCV generalmente es diagnosticada mediante la prueba de ELISA, que detecta la presencia de anticuerpos totales contra el virus de la hepatitis C (anti-HCV) (1). Sin embargo, en el 2004, un nuevo escenario clínico denominado hepatitis C oculta (HCV-Oc) fue descrito (20). Este tipo de infección se caracteriza por la detección del genoma viral, preferentemente en tejido hepático o mononucleares de sangre periférica, en pacientes con elevación o no de transaminasas, y ELISA anti-HCV negativo (21).

Este tipo de infección ha sido descrito por diversos autores en pacientes con enfermedad hepática criptogénica (20), y está presente hasta en el 57% de los casos. Factores del hospedero como la respuesta inmune han sido asociados con el desarrollo de HCV-Oc, evidenciándose una mayor respuesta de proliferación de linfocitos TCD4, y mayores recuentos de CD8 en pacientes con este escenario clínico vs. pacientes con hepatitis C crónica. Dentro de los factores virales estudiados, se encuentra el genotipo infectante; hasta la fecha, todos los aislados caracterizados en pacientes con HCV-Oc han sido identificados como genotipo 1b (21), e indican la existencia de alguna diferencia molecular en este genotipo.

Dada la alta frecuencia de HCV-Oc en pacientes con enfermedad hepática criptogénica, y a la ausencia de estudios de este tipo en Colombia, con el desarrollo del presente estudio se pretendió determinar la presencia del genoma del HCV en muestras de diferente origen, pertenecientes a un paciente que requirió retrasplante hepático por falla del injerto. Se detectó genoma viral en muestras de tejido del hígado nativo y del primer injerto. Al realizar análisis filogenéticos de los aislados detectados, se encontró que ambas cepas pertenecían al genotipo 1a, indicando que fue el mismo agente el desencadenante de los cuadros de falla hepática. El presente estudio se constituye en la primera evidencia en el mundo de HCV-Oc causada por el genotipo1a, en el contexto órgano trasplantado, y así mismo el primer reporte de HCV-Oc en Colombia. Se recomienda hacer la detección del genoma del HCV en muestras de tejido hepático (tejido embebido en parafina, fresco congelado, o proveniente de láminas de patología fijadas o coloreadas) con el fin de descartar una infección oculta por el HCV en casos de cirrosis, HCC y falla hepática de origen desconocido.

Paciente y métodos

Tipo de estudio

Descriptivo retrospectivo.

Paciente

Un hombre de 29 años, proveniente de la ciudad de Barranquilla, fue atendido el 21 de diciembre de 2006 por el grupo de trasplante hepático Universidad de Antioquia-Hospital Pablo Tobón Uribe, por un cuadro consistente en náuseas, diarrea y dolor abdominal persistente. Durante la evaluación se encontró ictericia mucocutánea y ascitis, acompañados de criterios clínicos y paraclínicos sugestivos de encefalopatía y coagulopatía. Se sospecha inicialmente cirrosis hepática asociada a enfermedad de Wilson o hemocromatosis, dado que no se encontraron marcadores serológicos para virus hepatotrópicos mediante prueba de ELISA (HBsAg, anti-HBc, anti-HCV; Roche), tampoco de autoinmunidad, ni de consumo de fármacos o tóxicos. Durante la evaluación oftalmológica no se evidenció anillo de Kayser-Fleischer. En estudios histopatológicos posteriores se reportaría positividad para marcación focal de hierro en células de Kuppfer y cobre negativo. A la evaluación histopatológica de cortes de tejido con coloración tricrómica, se observó fibrosis pericelular focal y fibrosis confinada al espacio porta (figura 1A). Debido al grado de la falla hepática y sus complicaciones, se realiza trasplante hepático el 24 de diciembre de 2006, y se inicia tratamiento con terapia inmunosupresora triple después del trasplante. A la evaluación macroscópica del explante (hígado nativo), se observó un órgano oscuro, de consistencia dura, aspecto nodular y clara evidencia de cirrosis (figura 1B).

Figura 1. Hallazgos histopatológicos en muestra de tejido hepático correspondiente al injerto rechazado. Se observa un órgano con lesiones nodulares, oscuro y con clara evidencia macroscópica de cirrosis. A. Lámina con coloración tricrómica realizada a partir de biopsia del hígado nativo. Se observan grandes bandas fibrosas. B. Órgano correspondiente al hígado nativo explantado en 2006.

La evolución inicial fue buena, sin embargo, el 18 de mayo de ese mismo año el paciente regresa a consulta por un cuadro de diarrea, prurito persistente e ictericia con una bilirrubina total mayor a 20 mg/dl, y marcada elevación de aminotransferasas. El reporte de la biopsia hepática obtenida evidenció rechazo celular agudo moderado a severo dictado por la presencia de infiltrado inflamatorio mononuclear, que comprometía la mayoría de los espacios porta, acompañado de numerosos eosinófilos y daño focal de la placa limitante. Se observó endotelitis y epitelitis, colestasis intracitoplasmática de hepatocitos, con acentuación hacia la zona  2 y 3, sinusoides congestivos y preservación de la vena centrolobulillar (figura 2A). No se observó colangitis ni malignidad; el tricrómico mostró fibrosis pericelular focal y fibrosis confinada al espacio porta. Los estudios serológicos fueron negativos para citomegalovirus, virus de la hepatitis B y HCV. En una segunda biopsia hepática, tomada el 26 de julio (figura 2B), se reportó rechazo crónico basado en la observación de marcada colestasis intracitoplasmática acompañada de balonamiento, sinusoides ligeramente congestivas y ductopenia en más del 50% de los espacios porta evaluados con preservación de la arteria y la vena hepática (tinción de citoqueratina 7). El paciente es retrasplantado el 7 de octubre de 2007 por diagnóstico de insuficiencia hepática secundaria a colestasis crónica severa de origen desconocido.

Figura 2. Hallazgos histopatológicos en muestra de tejido hepático correspondiente al injerto A. Se observan bandas fibrosas delimitando nódulos de hepatocitos e infiltrado mononuclear rodeando conductos. B. Se observan las venas centrales permeables pero con cambios isquémicos en hepatocitos de la zona tres con colestasis.

Actualmente, el paciente se encuentra medicado con Tacrolimus 5 mg, Micofenolato 500 mg y Prednisolona 5 mg. A la fecha, no ha presentado alteraciones bioquímicas, ni expresión clínica de rechazo o hepatitis. Dado que los dos cuadros de falla hepática no pudieron ser asociados a ningún factor conocido, el paciente acepta participar de manera voluntaria en el proyecto.

Muestras

Debido a los procedimientos quirúrgicos y a los estudios bioquímicos realizados al paciente, para el presente estudio se pudo contar con varios tipos de muestras, así:

Primer trasplante (24 de diciembre de 2006): Muestra de Suero y explante hepático (hígado nativo).

Segundo trasplante (7 de octubre de 2007): Muestra de Suero, plasma, buffy coat y explante hepático (primer injerto).

En todos los casos, una vez recolectado el tejido hepático fresco y las muestras de sangre, fueron almacenados a -70ºC hasta su procesamiento.

Detección del genoma del virus de la hepatitis C

Con el fin de determinar la presencia del genoma del HCV en las muestras clínicas obtenidas, ARN total fue extraído mediante el método de TRIzol (Invitrogen), siguiendo las recomendaciones de la casa comercial. Una vez obtenido el material genético, se amplificó por RT-PCR una secuencia altamente conservada para el HCV (7), mediante la utilización de cebadores que flanqueaban específicamente la región 5’UTR: para transcripción reversa y primera ronda el set de primers ATACTCGAGGTGCACGGTCTACGAGACCT/nt299-nt327 y CTGTGAGGAA CTACTGTCTT/nt23-nt42, y para la segunda ronda el grupo de primers CACTCTCGAGCACCCTATCAGGCAGT/nt266-nt292 y TTCACGCAGAAAGCGTCTAG/nt41-nt60. En ambos pasos de PCR se utilizó el protocolo de ciclaje de 94ºC por 2 minutos para desnaturalización, seguido de 40 ciclos de amplificación que incluyeron desnaturalización por 30 segundos a 94ºC, annealling a 56ºC por 30 segundos y extensión durante 1 minuto y 30 segundos a 72ºC, acompañado de una extensión fina de 72ºC por 10 min. Para la visualización de los productos amplificados, geles de agarosa al 2% fueron teñidos con bromuro de etidio (10 ug/ml) y corridos durante 1 hora a 100 voltios. Como marcador de peso molecular, se utilizó un escalera alélica con incremento de 100pb (Fermentas). Una vez terminado el corrido, los geles fueron fotodocumentados en el 2UV transiluminator Digital Imaging System. La presencia del genoma del HCV fue considerada cuando se observara un fragmento amplificado de 251 pb. Como control positivo de los ensayos se utilizaron tejidos y/o muestras de suero de pacientes con diagnóstico de cirrosis y/o HCC, anti-HCV positiva por ELISA, con prueba de RT-PCR HCV-específica positiva en ensayo independiente previamente realizado. Como control negativo se utilizó blanco de reactivo o muestras de pacientes con hepatitis crónica relacionado a enfermedad autoinmune. Todos los ensayos fueron efectuados por triplicado y confirmados por un laboratorio internacional de referencia (Laboratorio de virología molecular IVIC).

Caracterización del genotipo viral

En caso de resultado RT-PCR positivo, los amplicones fueron sometidos a secuenciación directa por un método automatizado (BigDyeTM terminator, secuenciador 3730xl). Una vez obtenidas las secuencias, fueron editadas y ensambladas utilizando el programa SeqMan de DNAstar. Luego de obtener los consensos, se realizó el alineamiento utilizando el programa BioEdit; para este análisis se usaron secuencias de prototipos disponibles en Genbank de cada uno de los genotipos del HCV y de algunos subtipos (tabla 1).

Tabla 1. Listado de secuencias prototipo Genbank utilizadas para el análisis filogenético del HCV.

Ya descartados los eventos de recombinación (Simplot), se realizaron las inferencias filogenéticas utilizando los métodos de máxima parsimonia, máxima verosimilitud y Neighbor joining (NJ) del paquete PAUP 4.0 (Sowford 1998). Para cada inferencia se generaron mínimo 100-1.000 réplicas de "Boostrap", con el fin de evaluar la confiabilidad de la topología. El árbol seleccionado fue obtenido por "Majority Rule" y visualizado en el programa TreeView. Como "outgroup" en los árboles con raíz, se utilizó la secuencia Y13184 perteneciente al genotipo 5 del HCV. El genotipo para cada aislado fue identificado de acuerdo al agrupamiento que generaron con las cepas referencia del Genbank. El análisis fue replicado usando el programa MEGA 4,1.

Análisis de substituciones en la región 5’UTR de los aislados del HCV detectados en el estudio

Para tratar de evaluar las diferencias nucleotídicas entre los aislados del HCV detectados en los explantes, las secuencias de la región 5’UTR fueron alineadas utilizando el programa Bioedit, junto a una secuencia prototipo colombiana perteneciente al genotipo 1b (HCVCol-172), previamente caracterizada, mediante RFLP y análisis de secuencias, por el grupo de los autores de Genotipificación del HCV en muestras obtenidas de pacientes multitransfundidos.

Resultados

Detección del genoma del HCV

Con el fin de determinar de manera retrospectiva la presencia del virus de hepatitis C, en muestras de diferente origen de un paciente con retrasplante de hígado, se implementó un protocolo previamente descrito de RT-PCR, el cual utiliza grupos de primers que flanquean una de las regiones genómica más conservadas del HCV. Una vez extraído el ARN total de las diferentes muestras y realizada la RT-PCR, se observó el producto específico esperado en las muestras de explante hepático del trasplante de 2006 y de 2007 (figura 3); cabe anotar que al evaluar la cantidad de muestra necesaria para la detección del genoma del HCV fue necesario utilizar el doble de muestra de tejido de 2007 vs. 2006 (200 y 100 mg, respectivamente), lo que indicaría un menor título de virus en esta muestra. Este análisis fue reproducible en tres ensayos realizados independientemente y confirmado por el laboratorio de virología molecular IVIC. Contrariamente, en ninguna de las muestras de suero, plasma o buffy coat fue detectable el genoma del HCV (figura 4). Los resultados mostrados aquí sugieren que el factor asociado a los episodios de falla hepática, y que llevaron al retrasplante del paciente, podría ser la infección oculta por el HCV.

Figura 3. Detección del genoma del HCV en muestras de tejido hepático de un paciente retrasplantado por falla hepática de origen desconocido. Productos de RT-PCR corridos en gel de garosa al 2%, teñido con bromuro de etidio. MP. Marcador de peso molecular con incrementos de 100pb. 1 y 2. ARN total extraído a partir de 100 mg de tejido hepático nativo. 3. ARN total de la muestra de suero obtenida en el trasplante de 2006. 4. ARN total obtenido de 200 mg de tejido hepático del primer injerto. 5. Control positivo del ensayo de extracción y RT-PCR (Muestra TH1). 6. Control negativo del ensayo de extracción y RT-PCR. Flecha blanca. Producto de PCR esperado específico para el HCV.

Figura 4. Detección del genoma del HCV en muestras de sangre de un paciente retrasplantado por enfermedad hepática criptogénica. Ensayo de electroforesis realizado a partir de los tubos de RT-PCR en los que se analizaron las muestras de sangre del trasplante de 2007. MP. Marcador de peso molecular con incremento de 100pb. 1-3. RNA total extraído a partir de las muestras de suero, plasma y buffy coat, respectivamente. 4-5. Controles positivos de extracción y RT-PCR (Muestras de tejido TH-1 y TH-2). 6. Control negativo del ensayo de RT-PCR. 7-9. Controles positivos de extracción y RT-PCR (Muestras de suero 033-sp, 050-sp y 215-sp). Flecha blanca. Producto de PCR esperado específico para el HCV.

Genotipificación de los aislados del HCV

En el presente estudio se realizaron análisis filogenéticos para tratar de inferir cuál era el genotipo presente en las muestras, y si el genotipo infectante era el mismo en ambos explantes. Al verificar los árboles filogenéticos generados, la topología fue muy similar independiente del método desarrollado. Así mismo, las secuencias de referencia Genbank utilizadas hicieron los agrupamientos esperados, los cuales fueron soportados por valores de bootstrap entre 49 y 94. Cuando se estudió la clada en la que se ubicaron las secuencias del HCV obtenidas de los explantes, se concluyó que ambos aislados pertenecían al genotipo 1a (figura 5); sin embargo, se encontraron en ramas separadas, lo que fue explicado en el análisis de comparación de secuencias con Bioedit por la presencia de dos substituciones transversionales en los nucleótidos 100 y 190 (cambio de adenina por citocina en ambos); en los restantes 249 nucleótidos las secuencias fueron idénticas (figura 6). Estas substituciones podrían ser explicadas por la alta tasa de mutación reportada por virus ARN, debido a la ausencia de acción correctora 3’-5’ de sus ARN polimerasas dependientes de ARN.

Figura 5. Caracterización molecular de los aislados detectados en los explantes hepáticos del caso de HCV-Oc. Árbol filogenético con raíz generado a partir del análisis de las secuencias 5’UTR del HCV con el método NJ, mediante el programa MEGA 4,1. Los números pequeños en las ramas internas representan el valor de bootstrap. Los números grandes en negrilla indican los agrupamientos por genotipos (1-6). En la ampliación se muestra la clada correspondiente al genotipo 1a. Rombo rojo 1stexpla. Aislado proveniente del tejido hepático nativo, Rombo verde 2ndexpla. Aislado proveniente del tejido hepático del primer injerto.

Figura 6. Caracterización de substituciones en la región 5’UTR de los aislados detectados en el presente estudio. Alineamiento de la secuencia 5’UTR mediante el programa Bioedit. Secuencia 1. Aislado de HCV colombiano perteneciente al genotipo 1b del HCV. Secuencia 2. Aislado del HCV proveniente del primer injerto. Secuencia 3. Aislado del HCV detectado a partir del tejido hepático nativo. En la secuencia 2 se observa la substitución A por C, en las posiciones 100 y 190 (con respecto al fragmento amplificado de 251 pb).

Discusión

La infección oculta por el virus de la hepatitis C es un nuevo escenario clínico a tener en cuenta en el marco de pacientes con cirrosis, carcinoma hepatocelular y/o falla hepática de origen desconocido. En este trabajo se pretendió identificar algún factor de riesgo desencadenante al desarrollo de falla hepática en un paciente sometido a dos trasplantes de hígado, encontrando el genoma del HCV en las muestras de tejido hepático obtenido tanto en el hígado nativo como en el primer injerto. Dado que durante los análisis nunca se detectó anticuerpos totales anti-HCV por ELISA, podemos concluir de manera lógica que la causa podría ser una infección oculta recurrente por el HCV.

Con el fin de asegurar la detección del genoma viral en las muestras clínicas, fue utilizado un procedimiento de RT-PCR anidado que contenía dos grupos de primers que presentaban como blanco una de las regiones más conservadas del HCV (7), el extremo no codificante 5’, primordial para la traducción del genoma viral (18).

A pesar de haber utilizado un protocolo anidado altamente sensible, el genoma del HCV solo fue detectado en tejido hepático y nunca en las muestras de sangre. Esto podría relacionarse con problemas de reproducibilidad de la técnica; sin embargo, podríamos descartar esa posibilidad ya que los controles funcionaron correctamente durante el desarrollo de todos los análisis. Un comportamiento similar ha sido reportado por otros autores, que encontraron que la muestra óptima para el diagnóstico molecular de casos de HCV-Oc es el tejido hepático (100% de casos detectables), seguido por mononucleares de sangre periférica (57%) y buffy coat (14%); al utilizar suero, plasma o sangre total, Carreño y col no lograron detectar ninguno de los casos de HCV-Oc (22).

Uno de los factores virales que ha sido estudiado en relación con la HCV-Oc es el genotipo infectante. En los estudios donde se han desarrollado análisis moleculares de los aislados, el único genotipo asociado al desarrollo de HCV-Oc ha sido el genotipo 1b (21), que a su vez es considerado uno de los más patogénicos por relacionarse con mayor riesgo de desarrollo de HCC (23). De manera sorprendente, el análisis filogenético de las secuencias caracterizadas en el presente trabajo arrojó que los aislados detectados en ambos tejidos correspondían al genotipo 1a. El hecho de que el mismo genotipo del HCV haya sido encontrado en el tejido hepático resecado de dos trasplantes totales de hígado en 2006 y 2007, soportaría la posibilidad de que fuese el mismo agente, y por lo tanto que sea la HCV-Oc el factor asociado a ambos episodios de falla hepática del paciente. Este estudio corresponde al primer reporte mundial en el que se identifica el genotipo 1a en un caso de HCV-Oc con el desenlace de retrasplante de hígado.

Aunque casos de HCV-Oc han sido reportados en pacientes con hepatitis crónica criptogénica y población en riesgo (hemodializados) (21), en Colombia no se ha adelantado ningún estudio. La infección oculta por el HCV tiene serias implicaciones en el diagnóstico, la transmisión y el tratamiento de esta entidad. Aunque se encuentra en evaluación el impacto que podría tener este escenario clínico en la severidad de la infección, el hallazgo reportado en el presente estudio hace necesario que en Colombia se sospeche de este tipo de casos en pacientes con cirrosis, HCC y falla hepática de origen desconocido, utilizando como muestra de elección para el diagnóstico tejido hepático y procedimientos de biología molecular de alta sensibilidad, como lo son el RT-PCR anidado y/o PCR en tiempo real. Actualmente el grupo de los autores está adelantando estudios adicionales tendientes a confirmar el genotipo viral mediante la amplificación de las regiones core y NS5b del HCV.

Agradecimientos

Los autores quieren agradecer a la doctora Flor Pujol por los ensayos realizados en el Laboratorio de virología molecular del Instituto Venezolano de Investigaciones Científicas. Así mismo, se agradece la financiación dada por Colciencias (Código: 115 041 6445).

Referencias

1. WHO and VHPB. Global surveillance and control of hepatitis C. Report of a WHO Consultation organized in collaboration it the Viral Hepatitis Prevention Board, Antwerp, Belgium. Journal of Viral Hepatitis 1999; 6: 35-47.        [ Links ]

2. Simmonds P. Viral heterogeneity of the hepatitis C virus. Journal of Hepatology 1999; 31(S1): 54-60.        [ Links ]

3. Rosenberg S. Recent advances in the molecular biology of hepatitis C virus. Journal of Molecular Biology 2001; 313(3): 451-64.        [ Links ]

4. Rijnbrand, RC, Lemon SM. Internal ribosome entry site-mediated translation in hepatitis C virus replication. Current Topics in Microbiology and Immunology 2000; 242: 85-116.        [ Links ]

5. Friebe P, Bartenschlager R. Genetic analysis of sequences in the 3’nontranslated region of hepatitis C virus that are important for RNA replication. Journal of Virology 2002; 76: 5326-5338.        [ Links ]

6. Robertson B, Myers G, Howard C, Brettin T, Bukh J, Gaschen B, Gojobori T, Maertens G, Mizokami M, Nainan O, Netesov S, Nishioka K, Shin T, Simmonds P, Smith D, Stuyver L, Weiner A. Classification, nomenclature, and database development for hepatitis C virus (HCV) and related viruses: proposals for standardization. International Committee on Virus Taxonomy. Archives of Virology 1998; 143: 2493-2503.        [ Links ]

7. Simmonds P, F McOmish, PL Yap, SW Chan, CK Lin, G Dusheiko, AA Saeed, EC Holmes. Sequence variability in the 5’ noncoding region of hepatitis C virus: identification of a new virus type and restrictions on sequence diversity. Journal of General Virology 1993; 74: 661-668.        [ Links ]

8. Davidson F, P Simmonds, JC Ferguson, LM Jarvis, BC Dow, EAC Follett, AJ Keller, T Kruisius C Lin, GA Medgyesu, H Kiyokawa, et al. Survey of major genotypes and subtypes of hepatitis C virus using RFLP of sequences amplified from the 5’non-coding region. Journal of General Virology 1995; 76: 1197-1204.        [ Links ]

9. Zein NN, J Rakela, EL Krawitt, KR Reddy, T. Tominaga, DH Persing, and the Collaborative Study Group. Hepatitis C virus genotypes in the United States: epidemiology, pathogenicity, and response to interferon therapy. Annals of Internal Medicine 1996; 125: 634-639.        [ Links ]

10. Nousbaum JB, S Pol, B Nalpas, P Landais, P Berthelot, C Brechot, and the Collaborative Study Group. Hepatitis C virus type 1b (II) infection in France and Italy. Annals of Internal Medicine 1995; 122: 161-168.        [ Links ]

12. Dehesa-Violante M, Bosques-Padilla F, Kershenobich-Stalnikowitz D; Mexican Study Group of Pegasys. Prevalence of hepatitis C virus genotypes in Mexican patients. Revista de Gastroenterología de México 2007; 72(4): 344-8.        [ Links ]

13. Cristina J. Genetic diversity and evolution of hepatitis C virus in the Latin American region. Journal of Clinical Virology 2005; 34: S1-S7.        [ Links ]

14. Gonzalo M, Mariela M, María FG, Katiuska G, Rodney C, Fernando LT, Lilia L, Ricardo R, Alejandro G S, María PM, Laura GA, Aura RM, Juan Cristina. Evolution of naturally occurring 5’non-coding region variants of Hepatitis C virus in human populations of the South American Region. Virology Journal 2007; 4: 79.        [ Links ]

15. Rodríguez-Pérez F, Suárez-Pérez E, Álvarez-Rohena M, Toro DH. Prevalence of chronic hepatitis C virus genotypes among patients between 21 to 65 years old in Puerto Rico. Puerto Rico Health Sciences Journal 2004; 23(2 Suppl): 49-56.        [ Links ]

16. Naoumov NZ, Rakela J, Krawitt EL. Hepatitis C virus genotypes in the United States. Epidemiology, pthogenicity, and response to interferon therapy. Annals of Internal Medicine 1997; 126: 634-39.        [ Links ]

17. Manns MP, McHutchison JG, Gordon SC, Rustgi VK, Shiffman M, Reindollar R, Goodman ZD, Koury K, Ling M, Albrecht JK. PegInterferon alfa-2b plus ribavirin compared with Interferon alfa-2b plus ribavirin inicial treatment of chronic hepatitis C a randomized trial. Lancet 2001; 358: 958-65.        [ Links ]

18. Friebe P, Bartenschlager R. Genetic analysis of sequences in the 3’nontranslated region of hepatitis C virus that are important for RNA replication. Journal of Virology 2002; 76: 5326-5338.        [ Links ]

19. Hadziyannis SJ, Sette H Jr, Morgan TR, Balan V, Diago M, Marcellin P, Ramadori G, Bodenheimer H Jr, Bernstein D, Rizzetto M, Zeuzem S, Pockros PJ, Lin A, Ackrill AM; PEGASYS International Study Group. PegInterferon-alpha2a and ribavirin combination therapy in chronic hepatitis C a randomized study of treatment duration and ribavirin dose. Annals of Internal Medicine 2004; 140: 346-55.        [ Links ]

20. Castillo I, Pardo M, Bartolomé J, Ortiz-Movilla N, Rodríguez-Inigo E, de Lucas S, Salas C, Jiménez-Heffernan JA, Perez-Mota A, Graus J, Lopez-Alcorocho JM, Carreño V. Occult hepatitis C virus infection in patients in whom the etiology of persistently abnormal results of liver-function tests is unknown. J Infect Dis 2004; 189: 7-14.        [ Links ]

21. Carreño V. Occult hepatitis C virus infection: A new form of hepatitis C. World J Gastroenterol 2006; 12(43): 6922-6925.        [ Links ]

22. Carreño V, Castillo I, Bartolomé J, Rodríguez-Inigo E, Ortiz-Movilla N, de Lucas S, Pardo M. Comparison of hepatitis C virus RNA detection in plasma, whole blood and peripheral blood mononuclear cells of patients with occult hepatitis C virus infection. J Clin Virol 2004; 31: 312-313.        [ Links ]

23. Raimondi S, Bruno S, Mondelli MU, Maisonneuve P. Hepatitis C virus genotype 1b as a risk factor for hepatocellular carcinoma development: a meta-analysis. J Hepatol 2009; 50(6): 1142-54.        [ Links ]

Creative Commons License All the contents of this journal, except where otherwise noted, is licensed under a Creative Commons Attribution License