SciELO - Scientific Electronic Library Online

 
vol.25 número1Development of a regeneration system in Papa criolla (Solanum phureja Juz et Buck) var. Yema de huevo clone 1Molecular cytogenetics in plant genome analysis índice de autoresíndice de assuntospesquisa de artigos
Home Pagelista alfabética de periódicos  

Serviços Personalizados

Artigo

Indicadores

Links relacionados

  • Em processo de indexaçãoCitado por Google
  • Não possue artigos similaresSimilares em SciELO
  • Em processo de indexaçãoSimilares em Google

Compartilhar


Agronomía Colombiana

versão impressa ISSN 0120-9965

Agron. colomb. v.25 n.1 Bogotá jan./jun. 2007

 

Propuesta de un sistema de transformación de plantas de papa (Solanum tuberosum sp. andigena var. Pastusa suprema) mediado por Agrobacterium tumefaciens

A system for transformation potato plants (Solanum tuberosum sp. andigena var. Pastusa suprema) mediated through Agrobacterium tumefaciens

 

Alfredo López1 y Alejandro Chaparro2

1 Microbiólogo, Grupo de Ingeniería Genética de Plantas, Departamento de Biología, Universidad Nacional de Colombia, Bogotá. e-mail: alopezmo@unal.edu.co

2 Profesor asistente, Grupo de Ingeniería Genética de Plantas, Departamento de Biología, Universidad Nacional de Colombia, Bogotá. e-mail: achaparro@unal.edu.co


Resumen: Se ha demostrado que la transformación de papa (Solanum tuberosum) mediada por Agrobacterium tumefaciens es dependiente del genotipo y que la mayoría de protocolos de transformación reportados son ineficientes al aplicarlos en la subespecie andigena. En esta propuesta se manejaron los procesos iniciales de mejoramiento genético de la nueva variedad colombiana de papa Pastusa suprema (Solanum tuberosum sp. andigena) que es altamente androestéril, característica de gran importancia para los organismos modificados genéticamente. Esta variedad resultó de la hibridación interespecífica de tres especies de papa (Solanum stoloniferum, Solanum phureja var. Yema de huevo y Solanum tuberosum sp. andigena var. Parda pastusa). Se transformaron explantes internodales mediante el vector pCambia2301 que posee un gen reportero de la Β-glucoronidasa y un gen de resistencia a la kanamicina. Se obtuvo un porcentaje de transformación inicial de 31 ± 2,5%, que se expresó mediante formación de callo sobre medios de selección y una frecuencia final con base en el ensayo GUS de 30%. Este es el primer reporte de transformación de un híbrido interespecífico de tres especies diferentes.

Palabras clave: híbrido interespecífico, transformación, genotipo, kanamicina, GUS.

Abstract: It has been demonstrated that Agrobacterium tumefaciens mediated-transformation of potato (Solanum tuberosum) was depended upon the genotype. In addition, most of the proposed protocols were inefficient to transform the andigena subspecies. In this proposal, the initial processes of genetic improvement of the new Colombian variety Pastusa suprema, which highly andro-sterile characteristic is of great importance for genetically modified organisms, were handled. This variety was produced across the inter-specific hybridization of three different species of potato (Solanum stoloniferum, Solanum phureja var. Yema de huevo y Solanum tuberosum sp. andigena var. Parda pastusa). Stem explants was transformed using the vector pCambia 2301, which has the gene reporter of Β-glucoronidase and the gene of resistance to kanamycin. Percentage initial transformation was expressed as formation of callus on a selection medium of 31 ± 2.5% with a final 30% frequency using GUS assay. It is the first report of a transformation process of an inter-specific hybrid derived from three different species.

Key words: inter-specific hybrid, transformation, genotype, kanamycin, GUS.

Fecha recepción: 02 de agosto de 2006 - Aceptado para publicación: 06 de junio de 2007


Introducción

LA PAPA ES UNO DE LOS CULTIVOS alimenticios más importantes del mundo (Estrada, 2000). Es el cuarto cultivo en el mundo después del trigo, el arroz y el maíz, con una producción anual aproximada de 300 millones de toneladas (Banerjee et al., 2006). Colombia produjo 2.834.820 t en el año 2002 en un área sembrada de 163.841 ha (CEVIPAPA, 2006).

La producción de papa se ve fuertemente reducida esencialmente por la presencia de enfermedades y ataques de insectos plaga. En Colombia, las principales pérdidas económicas se deben al ataque de la Polilla guatemalteca (Tecia solanivora Lepidoptera: Gelechiidae). Esta plaga se presenta en más del 80% de las zonas cultivadas del país y genera una disminución de los rendimientos superior al 30%. Este insecto no sólo está presente en América Latina, sino también en África, Asia y en el sureste de Europa, y fue reportado en Colombia por primera vez en 1985 (Arévalo, 2003). Para su control, los agricultores acuden al uso de una gran cantidad de plaguicidas químicos que se aplican con demasiada frecuencia. Este hecho, además de incrementar sustancialmente los costos de producción, origina una serie de problemas secundarios, entre ellos el desarrollo de resistencia a los plaguicidas (Sánchez et al., 2000).

En el contexto de las múltiples estrategias agrupadas bajo el concepto de manejo integrado de plagas (MIP) se propone la obtención de variedades de plantas que posean resistencia a los insectos plaga. Una tecnología que se viene explorando recientemente, y que puede servir como complemento al MIP para ofrecer soluciones parciales al problema, es la utilización de plantas transformadas con genes que confieren resistencia a los insectos plaga (Chaparro et al., 2003).

En el transcurso de los últimos 15 años se han obtenido cultivares transgénicos de papa con resistencia a diferentes factores bióticos (virus, bacterias, hongos, nematodos e insectos) y abióticos (estrés fisiológico, sequía, salinidad, frío), y con modificaciones en algunos procesos de desarrollo (crecimiento, floración, tuberización) (Ritter, 2000), aunque un gran porcentaje de estos trabajos se han realizado casi exclusivamente con variedades de Solanum tuberosum sp. tuberosum. Existen algunos pocos reportes sobre trabajos en especies de Solanum tuberosum sp. andigena, cultivo que se limita a los países de la región andina de Suramérica (Banerjee et al., 2006). En cuanto a las variedades colombianas los trabajos de trasformación son escasos; actualmente la Universidad Nacional de Colombia sede Bogotá y la Corporación para Investigaciones Biológicas (CIB) –en convenio con la Universidad Nacional sede Medellín–, se encuentran investigando en esta área; estos últimos reportaron en 2001 transformación mediante genes reporteros en algunas de las principales variedades comerciales de papa cultivadas en Colombia: 'Diacol capiro' y 'Parda pastusa' (Trujillo et al., 2001). La mayoría de métodos reportados para la obtención de plantas transformadas de papa (Solanum tuberosum sp. tuberosum) han mostrado ser ineficientes en las transformaciones de la subespecie andigena debido, entre otras causas, a la baja regeneración de brotes sobre el medio usado (Trujillo et al., 2001).

En el año 2002 se liberaron comercialmente tres nuevas variedades de papa subespecie andigena desarrolladas por un equipo de investigadores de la Universidad Nacional de Colombia sede Bogotá, entre las que se destaca la variedad Pastusa suprema resultado de la hibridación de un clon interespecífico (Solanum stoloniferum 230490 × Solanum phureja var. Yema de huevo) como parental materno con Solanum tuberosum sp. andigena var. Parda pastusa como parental paterno (Ñústez, 2005). Esta nueva variedad posee cierta resistencia a Phytophora infestans agente causal de la enfermedad de la Gota y se considera como la de mayor potencial comercial en los mercados colombianos dado que tiene características fenotípicas similares a las de 'Parda pastusa', la más importante variedad a nivel nacional (Perfetti et al., 2003). Ensayos realizados en campo con esta variedad han mostrado propiedades de androesterilidad, característica importante para la bioseguridad de los organismos genéticamente modificados en relación con el flujo de genes (Ñústez, 2005).

Aunque existen algunos autores que proponen que los sistemas de transformación son independientes del genotipo (Kumari et al., 1995; De Block, 1988), hay suficiente evidencia que señala que el método de transformación a utilizar está condicionado por el genotipo de la variedad que se esté trabajando (Dale y Harnpson, 1995; Trujillo et al., 2001; Heeres et al., 2002). Por tanto, es necesario evaluar la capacidad de transformación de la nueva variedad Pastusa suprema empleando genes reporteros y marcadores de selección para obtener protocolos estándar que permitan en el próximo futuro la introducción de genes de resistencia a insectos plaga y/o a condiciones bióticas y abióticas adversas, como la sensibilidad a heladas (Navia, 2005).

Materiales y métodos

Material biológico

Las plántulas de papa in vitro de la variedad 'Pastusa suprema' fueron provistas por el profesor Carlos Ñústez de la Facultad de Agronomía de la Universidad Nacional de Colombia sede Bogotá. El mantenimiento in vitro del material vegetal se realizó utilizando el medio Murashige y Skog (MS) suplementado con tiamina (0,4 mg· L-1), ácido D-pantoténico (2 mg· L-1), inositol (100 mg· L-1) y sacarosa (20 g· L-1) (Trujillo et al., 2001). Se adicionó además ácido giberélico, AG3 (0,1 mg· L-1) con el fin de estimular la elongación de los tallos y una concentración de Phytagel (Sigma-Aldrich) de 2,5 g· L-1. Las plántulas fueron subcultivadas transfiriendo las porciones caulinares apicales a medio fresco cada cinco semanas; por su parte, los explantes sometidos al proceso de transformación se subcultivaron cada dos semanas. El crecimiento del material vegetal se llevó a cabo a una temperatura promedio 20 ± 3°C con un fotoperíodo de 10 horas. Las bacterias utilizadas en la replicación del plásmido y su transferencia al genoma vegetal, Escherichia coli cepa DH5Α y Agrobacterium tumefaciens cepa LBA4404, fueron cedidas por el Centro Internacional de Agricultura Tropical (CIAT) y la Corporación para Investigaciones Biológicas (CIB), respectivamente.

Transformación bacteriana y vegetal

El vector pCambia 2301 que contiene el gen marcador nptII y el gen reportero gus, se introdujo a E. coli y A. tumefaciens mediante choque térmico con base en los protocolos descritos por Lima (1998) y Lacorte y Romano (1998).

Una vez fue transformada A. tumefaciens se cultivó en 20 ml de medio líquido Luria Bertani suplementado con antibióticos (estreptomicina y kanamicina, 50 mg· L-1 de cada uno), se incubó a 28°C y se centrifugó a 180 rpm hasta obtener una lectura OD600 de 0,8-1,0. El proceso de transformación vegetal se realizó usando la metodología propuesta por Ghislan (2003) con algunas variaciones basadas en las experiencias del grupo de Ingeniería Genética de Plantas de la Universidad Nacional de Colombia (IGP-UN) y en bibliografía obtenida sobre transformaciones genéticas de papa (Solanum sp. tuberosum y andigena), así: se inició tomando como explantes segmentos internodales de aproximadamente 0,4 a 0,8 cm provenientes de plantas micropropagadas de tres a cuatro semanas de edad (Jiménez, 2006). Para este ensayo se utilizaron 150 explantes derivados de plántulas cultivadas in vitro durante cuatro semanas a los cuales se les practicó un pequeño corte longitudinal para exponer las zonas internas del explante a la infección por parte de las bacterias (Beaujean et al., 1998). Se tomaron grupos de 50 explantes y se colocaron en el medio de cocultivo que consistía de medio MS líquido + vitaminas + 20 mg· L-1 de acetosiringona (Dale y Harpson, 1995). Los explantes se pusieron en contacto con la suspensión bacteriana en una proporción 1:50 y se agitaron manualmente durante 30 minutos (Yaya, 2006). Se tomó como control un grupo de 50 explantes a los cuales no se les sometió a cocultivo y se trasladaron directamente a medio de cultivo sólido (MS sin hormonas).

Por su parte, los explantes cocultivados se retiraron y se pusieron a secar en papel absorbente estéril y posteriormente se trasladaron a cajas de Petri que contenían medio de cocultivo sólido. Las cajas con los explantes cocultivados y los controles se incubaron en oscuridad a una temperatura de 20±3°C por un período de 48 horas. Posteriormente, los explantes se transfirieron a un medio de regeneración que consistía en medio MS sólido + vitaminas + hormonas (3,0 mg· L-1 de zeatina ribósido, ZR; 1,0 mg· L-1 de ácido giberélico, AG3 y 0,02 mg· L-1 de ácido naftalenacético, ANA) (Jiménez, 2006) suplementado con 250 mg· L-1 de cefatoxime por siete días (Visser et al., 1989). Transcurrida una semana, los explantes se trasladaron al mismo medio pero suplementado con 50 mg· L-1 de kanamicina (Andersson et al., 2003). Se hicieron réplicas de 10 explantes cada una para los cocultivados y cinco réplicas de 10 explantes cada una para los controles. El cambio a medio fresco se realizó cada dos semanas. Se evaluaron las condiciones durante el proceso de transformación en cuanto al porcentaje de callogénesis, regeneración, oxidación y/o clorosis. Se evaluaron las diferencias estadísticas entre los tratamientos (con cocultivo y sin cocultivo) mediante la prueba W de Mann Whitney. Se utilizó el programa Stat Graphics° versión 4.0 y para todos los análisis se asumió un nivel de confiabilidad de 95%.

Ensayo histoquímico GUS

La actividad del gen gus se evidenció por medio del ensayo histoquímico GUS modificado por Lacorte (1998). Se tomaron aleatóriamente el 50% de los explantes viables en proceso de callogénesis de 3 a 4 semanas de edad provenientes de los explantes control y cocultivados para realizar el ensayo. La preparación de 400 µL de la solución de X-Gluc 50 mg· mL-1 se realizó pesando 20 mg de X-Gluc y disolviéndolo en 0,4 ml de DMSO (dimetilsulfóxido). La solución se adicionó a 40 ml de tampón de reacción compuesto por NaH2PO4. H2O 100 mM, Na2EDTA.2H2O 10 mM, Triton X-100 0,1%, X-Gluc 50 mg· mL-1 1 mM, aforando a 40 mL con agua destilada estéril.

Los callos se retiraron del medio de regeneración y se enjuagaron con agua destilada estéril para retirar los restos de medio que quedan adheridos, se colocaron a secar sobre papel absorbente y se depositaron en tubos Eppendorf estériles de 1,5 mL de volumen; a continuación se les adicionó el tampón de reacción citado en un volumen suficiente para cubrir la muestra. Posteriormente se incubaron en oscuridad a una temperatura de 37ºC por 17 horas aproximadamente. El tampón de reacción se retiró y se adicionó etanol al 70% para interrumpir la reacción y retirar la clorofila. Después de 17 horas se lavaron las muestras en agua destilada y se transfirieron a glicerol 50% en una caja de Petri. Finalmente las muestras se visualizaron en estereoscopio.

Extracción de DNA vegetal

Se ensayaron diferentes protocolos de extracción de DNA (Edwards et al., 1991; Romano, 1998; Herrera et al., 2000). La escogencia del mejor protocolo se basó en la calidad de la extracción del DNA genómico de plantas micropropagadas analizada por electroforesis en geles de agarosa y se comprobó por la ausencia de inhibidores interferentes por digestión con la enzima HindIII y por amplificación de segmentos al azar utilizando iniciadores tipo RAPD.

Análisis molecular por PCR

Se llevaron a cabo tres tipos de reacciones de PCR durante el proceso de transformación con los objetivos de evaluar la calidad del DNA extraído y detectar la presencia del gen endógeno y del transgen. La primera reacción de amplificación corresponde a la efectuada con los primers tipo RAPD de 10 oligonucleótidos de secuencias aleatorias (Operon Biotechnologies, Inc.) La secuencia del primer utilizado fue: 5'AGGTGACCGT3'. Las reacciones de PCR de 25 µL contenían 200 ng de DNA genómico de plántulas micropropagadas, buffer 1X (50 mM KCl, 10 mM Tris HCL, pH 8,3), 1,0 mM de MgCl2, 0,1 µM de dNTPs, 1,0 µM de cada primer y 1,25 U de taq-polimerasa. La segunda reacción de amplificación corresponde a la que se realizó sobre el material transformado y el grupo control para amplificar un fragmento del gen nptll. Se utilizaron las mismas condiciones de la mezcla de la primera reacción. La tercera reacción corresponde a la que se hizo para amplificar el gen mitocondrial cox que codifica para la citocromo oxidasa en los explantes control y los explantes transformados, así como en plantas micropropagadas para evaluar calidad de la extracción. Los primers utilizados fueron Cox1 5'CGTCGCATTCCAGATTATCCA3' y Cox2 5'CAACTACGGATATATAAAGCCAAAA CTG 3' (Weller et al., 2000) que definen un fragmento de 96 pb. Esta reacción en explantes control y cocultivados se realizó paralelamente a la amplificación del transgen y sirvió como un control interno de la PCR. Como control negativo se utilizaron muestras provenientes de los materiales no sometidos a cocultivo y como control de la contaminación se usó como muestra agua destilada estéril.

Todas las reacciones de amplificación fueron realizadas utilizando el kit TucanTaq® (Corpogen) y llevadas a cabo en un termociclador (Biorad®), programado para un ciclo de 94°C/1 min, 38 ciclos de 94°C/1 min, 59°C/1 min y 72°C/2 min cada uno, con una extensión final de 72°C durante 7 min para la amplificación del transgen y del gen endógeno; y de un ciclo de 94°C/5 min, 35 ciclos de 94°C/30 seg, 36°C/1 min y 72°C por 1 min 30 seg cada uno, con una extensión final de 72°C durante 5 min para los primers tipo RAPD. Los productos de PCR provenientes de la amplificación de los genes nptII y cox se analizaron en un gel de agarosa al 2%, teñido con bromuro de etidio, usando el buffer 1X Tris Borato EDTA como buffer de corrida. Para la reacción con los primers tipo RAPD se usaron las mismas condiciones pero utilizando un gel de agarosa al 1%.

Transformación bacteriana y vegetal

Se obtuvieron cepas transformadas de E. coli y A. tumefaciens con el vector pCambia2301 utilizando el protocolo de choque térmico, las cuales fueron confirmadas por la extracción del DNA plasmídico y la posterior amplificación del gen nptII (datos no mostrados).

El protocolo de transformación vegetal utilizado en este ensayo, que se basó en el propuesto por Ghislan (2003) con algunas modificaciones, avanzó en el camino de obtener un sistema de transformación para la nueva variedad de papa Pastusa suprema. Estas modificaciones se basaron en reportes de transformación de papa (Visser et al., 1989; Dale y Harnpson, 1995; Beaujean et al., 1998; Trujillo et al., 2001; Andersson et al., 2003). El medio de regeneración y el tipo de explante procedente de entrenudos utilizados fue el propuesto por Jiménez (2006). Se ha reportado que trabajar con entrenudos facilita las primeras etapas del proceso debido a que son menos susceptibles a sufrir lesiones durante los diferentes pasos de manipulación (Beaujean et al., 1998).

A los explantes sometidos a transformación se les practicó un pequeño corte para estimular la actividad de transferencia de A. tumefaciens debido a la exudación de compuestos fenólicos que actúan como quimio-atrayentes; se reportó el inició de formación de una pequeña capa de callo en los sitios de corte y la aparición de pequeños brotes (Visser et al., 1989). Por otro lado, el corte puede permitir que la bacteria infecte las células internas del explante, como se pudo visualizar en los cortes internos de los callos GUS positivo (datos no mostrados). Sin embargo, el corte también puede inducir efectos deletéreos en los explantes más pequeños.

La concentración de la suspensión bacteriana se tomó con base en el trabajo de Trujillo et al. (2001), en el cual se evaluaron dos concentraciones (1:50 y 1:10) en la transformación de dos variedades de papa subespecie andigena, obteniendo mejores resultados para una variedad con la concentración 1:50, y para otra variedad con la concentración 1:10. Ambas concentraciones fueron válidas, pero para este ensayo se descartó la concentración 1:10 dado que, en una experiencia previa con la variedad 'Diacol capiro' utilizando esa concentración, se comprobó sobreinfección en los explantes (Yaya, 2006). Después del proceso de cocultivo los 150 explantes se colocaron en medios sin selección por una semana. En el transcurso de este tiempo más del 90% de los explantes cocultivados y control empezaron a presentar un ensanchamiento en uno o en ambos extremos mostrando indicios de callogénesis; sólo el 10% de los explantes control presentaron procesos de oxidación leves. No hubo procesos de clorosis.

Investigaciones realizadas por Visser et al. (1989) con transformaciones de Solanum tuberosum sp. tuberosum, partiendo de segmentos foliares o de entrenudos, en las cuales se evaluó la transferencia directa del cocultivo al medio de selección o dejando una semana en medio de regeneración sin antibióticos, obtuvieron mejores porcentajes de transformación cuando dejaban los explantes una semana sin presión de selección ya que se comenzaba a presentar división celular en los explantes sin estrés por la ausencia del antibiótico (Visser et al., 1989). En este ensayo se observó un hecho similar ya que los explantes empezaron a presentar procesos de división celular e indicios de callogénesis. Sin embargo, en este espacio de tiempo se pudo presentar proliferación de algunas células no transformadas y haber contribuido a la presencia de escapes (explantes no transformados con resistencia natural). Para un próximo ensayo se podría evaluar la variante de disminuir el número de días sin presión de selección o pasar directamente a los medios de selección (Trujillo, 2001; Banerjee, 2006).

Después de la primera semana sin selección los explantes se trasladaron a medios con selección por parte del antibiótico kanamicina a una concentración de 50 mg· L-1. Se escogió debido a que varios reportes citan que dicha concentración es óptima para la obtención de una alta frecuencia de brotes de papa transgénica en combinación con un alto número de brotes regenerados por explante (Ooms, 1987; Tavazza, 1988; Wenzler, 1989; Higgins, 1992, citados por Andersson et al., 2003). En la segunda semana de transformación muchos explantes sufrieron la presencia del antibiótico, lo cual se hizo evidente por la presencia de procesos de oxidación y de clorosis. Se presentaron mayores impactos sobre los explantes cocultivados los cuales tuvieron una drástica disminución en su viabilidad (figura 1). Este comportamiento puede describirse mejor basado en los resultados del análisis de más de 20 variedades de papa obtenidos por Dale y Harnpson (1995) en los que la variación observada en la respuesta de regeneración fue atribuida en un 35 % a la variedad como tal; sin embargo, ello también indica que el 65% restante puede atribuirse a variaciones fisiológicas y otras fuentes de variación, como podría ser la presencia del antibiótico y/o sus diferentes concentraciones o el momento del cocultivo con la cepa de A. tumefaciens, ya que este ataque puede causar un efectos deletéreos en el genoma vegetal en el momento de la infección que pueda interferir con los procesos regenerativos (Tzfira y Citovsky, 2006).

En la tercera semana de transformación continuaron los efectos del antibiótico sobre algunos de los explantes control y los sometidos a transformación, pues aparecieron procesos de oxidación y pérdida de viabilidad. Sin embargo, como se observa en la figura 1, los explantes control y cocultivados no mostraban hasta ese momento diferencias sustanciales entre ellos (3,4 ± 3,01 vs. 4,2 ± 3,1). Por esta razón se decidió aumentar levemente la concentración del antibiótico a 75 mg· L-1 para poder detener el crecimiento en los controles de los escapes, explantes que presentan una tolerancia natural frente a algunos antibióticos, sin llegar a afectar el crecimiento de los explantes transformados. En la cuarta semana de transformación la callogénesis en los explantes viables fue más visible (figura 2). En la quinta semana de transformación se hicieron más notorios los efectos del aumento del antibiótico sobre los callos cocultivados debido a que empezaron a perder viabilidad, descartando de esta forma los callos que podrían ser escapes; posiblemente por esta razón 2% de los callos transformados que permanecieron viables comenzaron a mostrar indicios de regeneración (figura 3). A pesar del aumento en la concentración del antibiótico no se observó ningún cambio en los explantes de las réplicas control que permanecieron viables desde la tercera semana; aparentemente en estos callos (6%) no se afectó su tolerancia natural y también empezaron a manifestar indicios de regeneración (figura 4). En las siguientes semanas del proceso de transformación no se presentó ningún cambio, manteniéndose constante el número de regenerantes y, por tanto, el porcentaje de regeneración. Los regenerantes que se presentaron, tanto en los callos control como en los callos transformados, permanecieron viables pero no siguieron creciendo en las dos semanas siguientes. Sin embargo, como se observó en las figuras 1 y 2, los callos sin proceso de regeneración empezaron a presentar procesos de oxidación y perdieron viabilidad. Al final los porcentajes de viabilidad (P = 0,654) y callogénesis (P = 0,947) en controles y cocultivados no mostraron diferencias estadísticamente significativas, demostrando posiblemente que la concentración de antibiótico usada para esta variedad no permitió una selección adecuada.

Durante el proceso de transformación utilizado en este ensayo se reportaron porcentajes de callogénesis de 31 ± 2,52% y de regeneración del 2 ± 0,77%. Comparando los resultados obtenidos en el presente trabajo con otros reportes de transformación en papa (tabla 1), resulta que los porcentajes de regeneración obtenidos son relativamente bajos, pero similares a los obtenidos por Dale y Harnpson (1995) con la variedad Pentland dell. Es importante señalar que la variedad Pastusa suprema, a la que corresponde el presente trabajo, pertenece a la subespecie andigena, mientras la variedad Pentland dell es de la subespecie tuberosum. Por otro lado, se obtuvieron porcentajes de callogénesis similares a los reportados por Valderrama (2004) para 'Parda pastusa' y 'Diacol capiro'.

Tabla 1

Ensayo GUS

El ensayo GUS fue aplicado entre la tercera y cuarta semana de cultivo a los explantes con procesos de callogenésis para analizar si el gene foráneo fue transferido, trascrito y traducido, y se hallaba codificando la enzima necesaria para metabolizar el sustrato. La presencia del intron de la catalasa ubicado en el medio de los exones GUS, asegura que el gen sólo se pueda expresar en un ambiente eucariota, puesto que en plantas el intron en el gen gus es eficientemente procesado, transcribiendo un RNA mensajero maduro y traduciendo la proteína GUS (Gilissen et al., 1998).

De los 13 callos cocultivados y evaluados, cuatro fueron positivos para la prueba GUS (figura 5); esto da como resultado una frecuencia de expresión GUS del 30%. La presencia de la coloración azul indicó que el sustrato había sido metabolizado y, por lo menos, el gen gus llegó al ambiente cromosómico del genoma de la papa. Por otra parte, si el gen no hubiese sido integrado en el genoma nuclear, después de más de tres semanas de constante división, habría sido eliminado del ambiente cromosómico.

Extracción del DNA vegetal

Con las tres metodologías ensayadas se logró obtener DNA, a partir del cual se consiguió realizar digestión con la enzima Hind III (datos no mostrados); además, la amplificación con los primers tipo RAPD fue positiva para todas. Sin embargo, como se observa en la figura 6, se observó un mejor patrón de bandas con el procedimiento propuesto por Herrera et al. (2000). Por esta razón se escogió este protocolo para realizar la extracción de DNA de los callos potencialmente transformados. Por otro lado, este protocolo elimina impurezas que puedan interferir con la PCR tales como polifenoles, proteínas, restos de detergentes y sales (acetato de amonio o acetato de sodio) (Innis y Gelfand, 1990).

Análisis molecular por PCR

En primer lugar se realizó la amplificación del gen endógeno cox a partir de DNA aislado con cada uno de los protocolos La amplificación se llevó a cabo bajo las mismas condiciones de la amplificación del gen nptII para que sirviera como control interno de la amplificación del gen de interés. Se observó amplificación el gen endógeno (figura 7) a partir del DNA aislado con cada uno de los protocolos.

La extracción de DNA (Herrera et al., 2000) se realizó a partir de callos derivados de explantes cocultivados en medios de selección, así como de callos derivados de explantes sin cocultivo en medios sin selección. Estas extracciones de DNA se utilizaron para realizar la amplificación del gen endógeno cox y del gen nptII (figura 8).

Como se puede observar en la figura 8 se obtuvo la amplificación del gen cox a partir de todas las muestras analizadas, pero no del gen nptII. Para eliminar cualquier artefacto del resultado en los ensayos de amplificación del gen nptII se hicieron algunas modificaciones: variación de la concentración de DNA entre 50-400 ng, reamplificaciones a partir del los productos de la primera amplificación, empleo de estimulantes de la reacción como diferentes concentraciones de DMSO (Innis y Gelfand, 1990). Sin embargo hasta el momento no se ha logrado obtener ninguna amplificación (datos no mostrados). Una posible explicación de este hecho, reportado también por Ming-Tsair (1996), es que el gen se haya perdido por efecto de replicación y reparación del casette de expresión, debido a eventos previos a la integración en el genoma hospedero o a que se haya presentado una delección parcial del T-DNA (Vries- Uijtewaal et al., 1989).

Conclusiones

Aunque algunos autores afirmen que los procesos de transformación son independientes del genotipo (De Block, 1988; Kumari et al., 1995), los valores obtenidos en este ensayo y los reportados para otros estudios de transformación en papa aportan mayor evidencia que los procesos de transformación son dependientes del genotipo, es decir de la variedad que se va a trabajar. Cada componente del proceso (tipo de explante, concentración de la bacteria, medio de cocultivo y tiempo de contacto, componentes del medio de selección y tiempos en general) dependen tanto de la especie, como de la subespecie o variedad que se vaya a trabajar (Figueira et al.,1994; Dale y Harnpson, 1995; Trujillo et al., 2001; Heeres et al., 2002). Con base en estos resultados es recomendable, en el momento de aplicar cualquier protocolo de transformación en papa, realizar las respectivas modificaciones para ser adaptado a la variedad que se vaya a trabajar.

Finalmente, se avanzó hacia la obtención de un sistema de transformación para la variedad 'Pastusa suprema' a pesar de las características particulares del material biológico: a) pool genético complejo resultante de una doble hibridación, siendo uno de los parentales un híbrido interespecífico; b) es una variedad muy nueva, sin protocolos de cultivo de tejidos ni de transformación genética; c) probabilidad que sea un genotipo recalcitrante para transformación como han sido reportadas algunas variedades de papa: 'Aracy' y 'Baronesa' (Figueira et al., 1994), 'Record' y 'Maris Piper' (Dale y Harnpson, 1995).

Debido a los problemas de enfermedades producidas por virus, bacterias y hongos (Estrada, 2000), el ataque de insectos plaga y las consecuencias económicas que conllevan (Sánchez et al., 2000), este trabajo abre perspectivas para obtener plantas transgénicas de la variedad Pastusa suprema con genes de interés agronómico. En Colombia son de interés aquellos genes que confieran resistencia a insectos lepidópteros, en especial a T. solanivora, así como a condiciones de estrés de tipo abiótico que es una de las mayores limitantes económicas (Martínez et al., 2003). Para el caso de 'Pastusa suprema' es relevante transferir genes que aporten resistencia a heladas, característica negativa de esta variedad (Navia, 2005).


Literatura citada

Andersson, M., A. Trifonova, A. Andersson, M. Johansson, L. Bulow y P. Hofvander. 2003. A novel selection system for potato transformation using a mutated AHAS gene. Plant Cell Rpt. 22, 261-267.         [ Links ]

Arévalo A. 2003. Análisis de la problemática en Colombia de la polilla guatemalteca de la papa Tecia solanivora. pp. 2425 En: CEVIPAPA (eds). Memorias Tecia solanivora II Taller Nacional. Bogotá, 190 p.         [ Links ]

Beaujean, A., R.S. Sangran, A. Lecardonnel y B.S. Sangran-Norreel. 1998. Agrobacterium mediated transformation of three economically important potato cultivars using sliced internodal explants: an eficient protocol of transformation. J. Expt. Bot. 49(326), 1589-1595.         [ Links ]

Banerjee, A.K., S. Prat y D. Hannapel. 2006. Efficient production of transgenic potato (S. tuberosum L. sp. andigena) plants via Agrobacterium tumefaciens mediated transformation. Plant Sci. 170, 732-738.         [ Links ]

CEVIPAPA. 2006. En: http://www.cevipapa.org.co/estadisticas/estadisticas. php#; consulta: junio 2006.         [ Links ]

Chaparro A, X. Sinisterra, O. Quintero y J. Santos. 2003. Transformación de papa criolla variedad 'Yema de huevo' con un gen que codifica para un inhibidor de proteasas derivado del pomelo. pp. 114-117. En: CEVIPAPA (eds). Memorias Tecia solanivora II Taller Nacional. Bogotá, 190 p.         [ Links ]

Dale, P. y K. Harnpson. 1995. An assessment of morphogenic and transformation efficiency in a range of varieties of potato (Solanum tuberosum L.) Euphytica 85, 101-108.         [ Links ]

De Block M. 1988. Genotype independent leaf disc transformation of potato (Solanum tuberosum) using Agrobacterium tumefaciens. Theor. Appl. Genet. 76, 767-774.         [ Links ]

Edwards, K., C. Johnstonen y C. Thompson. 1991. A simple and rapid method for the preparation of plant genomic DNA for PCR análisis. Nucleic Acids Res. 19(6), 1349.         [ Links ]

Estrada, N. 2000. La biodiversidad en el mejoramiento genético de la papa. PROINPA, CIP, CID. La Paz, 372 p.         [ Links ]

Figueira, E.S., L.F. Figueiredo y D.C. Monte Neshich. 1994. Transformation of potato (Solanum tuberosum) cv. Mantiqueira using Agrobacterium tumefaciens and evaluation of herbicide resistance. Plant Cell Rpt. 13(12), 666-670.         [ Links ]

Ghislan M. Comunicación escrita. Mejoramiento y recursos genéticos. Centro Internacional de la Papa. -CIP-. e-mail: m.ghislain@cgiar.org; consulta: julio 2003.         [ Links ]

Gilissen, L., L.J., Metz, W.J. Stiekema y J.P. Nap.1998. Review Biosafety of E. coli B-glucuronidase (GUS). Plants Transgenic Res. 7, 157-163.         [ Links ]

Heeres P., M. Schippers-Rozenboom, E. Jacobsen y R. Visser. 2002. Transformation of a large number of potato varieties: genotyLópez y Chaparro: Avances hacia la obtención de un sistema... 25 2007 pedependent variation in efficiency and somaclonal variability. Euphytica 124, 13-22.         [ Links ]

Herrera, M., M. Ghislain y D. Zhang. 2000. Molecular biology laboratory protocols: Plant genotyping, crop improvement and genetic resources department training manual. International Potato Center (CIP). 3a edition. Lima, Perú.         [ Links ]

Innis, M. y D. Gelfand. 1990. Substances affecting PCR: inhibition or Enhancement. PCR protocols: A guide to methods and applications. Academic Press Inc.         [ Links ]

Jiménez, J. 2006. Regeneración de Solanum tuberosum L. variedad 'Pastusa suprema' a partir de explantes internodales. Trabajo de grado. Departamento de Biología, Universidad Nacional de Colombia, Bogotá.         [ Links ]

Kumari, A., M. Miller, P. Whitty, J. Lyon y P. Davie. 1995. Agrobacterium mediated transformation of five wild Solanum species using in vitro microtubers. Plant Cell Rept. 14, 324-328.        [ Links ]

Lacorte, C. 1998. Β-glucuronidase (GUS). pp. 128-129. En: Braileiro y Carniero (eds.). Manual de transformação genética de plantas. EMBRAPA, SPI/Embrapa, Cenargen, Brasilia. 309 p.         [ Links ]

Lacorte C. y E. Romano. 1998. Transferencia de vetores para Agrobacterium. pp 103-106. En: Braileiro y Carniero (eds.). Manual de transformação genética de plantas. Embrapa, SPI/Embrapa, Cenargen, Brasilia. 390 p.         [ Links ]

Lima, F.J. y E.L. Rech. 1998. Isolamento de vetores para transformação direta. pp. 1821. En: Braileiro y Carniero (eds.). Manual de transformação genética de plantas. Embrapa, SPI/Embrapa, Cenargen. Brasilia. 309 p.         [ Links ]

Martinez, H., C. Barrios y X. Acevedo. 2003. Características y estructura de la cadena de la papa en Colombia. Documento del Ministerio de Agricultura y Desarrollo Rural, Observatorio de Agrocadenas, Bogotá. Ming Tsair, C., LiangJwu, C. y HsinHsiung, C. 1996. Expression of Bacillus thuringiensis (B.t.) insecticidal crystal protein gene in transgenic potato. Botanical Bul. Academia Sinica 37, 1723.         [ Links ]         [ Links ]

Navia, S. 2005. Entrevista en crónica: La papa 'Pastusa suprema' llega a los platos de los colombianos. En: www.portafolio.com. co. Bogotá; consulta: abril de 2006.        [ Links ]

Ñústez, C. 2005. Comunicación personal. Director grupo de investigación en papa. Facultad de Agronomía, Universidad Nacional de Colombia, Bogotá.         [ Links ]

Perfetti, J., C. Téllez y C. Correa. 2003. Sistema de inteligencia de mercados. Ministerio de Agricultura y Desarrollo Rural. Perfil del producto papa. Corporación Colombia Internacional. Bogotá. En: http://www.agronet.gov.co/www/docs_ agronet/2005113143530_perfil_papaOk.pdf; consulta: mayo 2006.         [ Links ]

Ritter, E. 2000. Aplicación de la biotecnología en la mejora genética de la patata. En: Pascualena J. y E. Ritter (eds.). Libro de Actas del Congreso Iberoamericano de Investigación y Desarrollo en Patata. Patata 2000. 3-6 julio, Vitoria-Gastéis, España.         [ Links ]

Romano, E. 1998. Extração de DNA de tecidos vegetais. pp 171. En: Braileiro y Carniero (eds.). Manual de transformação genética de plantas. Embrapa, SPI/Embrapa, Cenargen. Brasilia. 309 p.        [ Links ]

Sánchez, G., E. Londoño, L.A. Peña y E. Espitia. Manejo Integrado de Plagas. En: Manejo integrado del cultivo de la papa. Manual técnico. Corpoica, Bogotá. 160 p.         [ Links ]

Trujillo, C., E. Rodríguez, S. Jaramillo, R. Hoyos, S. Orduz y R. Arango. 2001. One step tranformation of two Andean potato cultivars (Solanum tuberosum L. sp. andigena). Plant Cell Rpt. 20, 637-641.         [ Links ]

Tzfira, T. y V. Citovsky. 2006. Agrobacterium mediated genetic transformation of plants: biology and biotechnology. Current Opinion Biotechnol. 17, 147-154.         [ Links ]

Valderrama A.M. 2004. Desarrollo de líneas de papa con posible resistencia a Tecia solanivora utilizando el gen cry1Ac de Bacillus thuringiensis. Tesis de Maestría en Biotecnología. Facultad de Ciencias. Universidad Nacional de Colombia, Medellin.         [ Links ]

Visser, R., E.L. Jacobsen, A. Hesseling-Meinders, M.J. Schans, B. Witholt y W.J. Feenstra. 1989. Transformation of homozygous diploid potato with an agrobacterium tumefaciens binary vector system by adventicious shoot regeneration of leaf and ítem segments. Plant Mol. Biol. 12, 329-337.         [ Links ]

Vries-Uijtewaal, L.J., W. Gilissen, E. Flipse, K. Sree Ramulu, W.J. Stiekema y B. de Groot. 1989. Fate of introduced genetic markers in transformed root clones and regenerated plants of monohaploid and diploid potato genotypes. Theor. Appl. Genet. 78, 185-193.         [ Links ]

Weller, S.A., J.G. Elphinstone, N.C. Smith, N. Boonham y D.E. Stead. 2000. Detection of Ralstonia solanacearum strains with a quantitative, multiplex, realtime, fluorogenic PCR (taqman) assay. Appl. Environ. Microbiol. 66(7), 2853-2858.         [ Links ]

Yaya, M.L. 2006. Desarrollo de un sistema de selección positiva para plantas transgénicas de papa (Solanum tuberosum sp. andigena var. 'Diacol capiro'). Tesis de Maestría en Ciencias Biologicas con énfasis en Genética. Departamento de Biología, Universidad Nacional de Colombia, Bogotá.        [ Links ]

 

Creative Commons License Todo o conteúdo deste periódico, exceto onde está identificado, está licenciado sob uma Licença Creative Commons