SciELO - Scientific Electronic Library Online

 
vol.36 issue1PHYLOGENETIC ANALYSIS WHITHIN THE PRISTIMANTIS UNISTRIGATUS (ANURA, CRAUGASTORIDAE) GROUP BASED ON MORPHOLOGICAL CHARACTERSPotentially toxic Dinoflagellates associated to drift in San Andres Island, International Biosphere Reservation - Seaflower author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Caldasia

Print version ISSN 0366-5232

Caldasia vol.36 no.1 Bogotá Jan./June 2014

http://dx.doi.org/10.15446/caldasia.v36n1.43895 

http://dx.doi.org/10.15446/caldasia.v36n1.43895

CONTRIBUCIÓN AL CONOCIMIENTO DE LAS ESPECIES DE HAPLOHYPHES ALLEN (INSECTA: EPHEMEROPTERA: LEPTOHYPHIDAE) EN COLOMBIA

Contribution to the knowledge of Haplohyphes Allen (Insecta: Ephemeroptera: Leptohyphidae) from Colombia

DIANA C. HOJOS
LUIS F. GARCÍA-T.
FREDY A. RIVERA-P.
GERMÁN A. LÓPEZ-G.
MARÍA DEL CARMEN ZÚÑIGA
LUCIMAR G. DIAS

Programa de Biología, Facultad de Ciencias Exactas y Naturales, Universidad de Caldas, Manizales, Colombia. Grupo de Investigación Genética, Biodiversidad y Manejo de Ecosistemas - GEBIOME. dicahoja@hotmail.com, luisfelgt@hotmail.com

Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas y Naturales, Universidad de Caldas, Manizales, Colombia. Grupo de Investigación Genética, Biodiversidad y Manejo de Ecosistemas - GEBIOME. fredy.rivera@ucaldas.edu.co

Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas y Naturales, Universidad de Caldas, Manizales, Colombia, german.lopez@ucaldas.edu.co

Departamento de Biología, Grupo de Investigaciones Entomológicas, Universidad del Valle, Cali, Colombia, maczuniga@gmail.com

Departamento de Ciencias Biológicas, Facultad de Ciencias Exactas y Naturales, Universidad de Caldas, Manizales, Colombia. Grupo de Investigación Genética, Biodiversidad y Manejo de Ecosistemas - GEBIOME. lucimar.dias@ucaldas.edu.co. Autor para correspondencia.

RESUMEN

Con el objetivo de contribuir al conocimiento de Haplohyphes en Colombia, se identificaron y asociaron ninfas y adultos de las especies del género utilizando caracteres morfológicos y moleculares. Para la obtención del material y revisión de la distribución de las especies en la región, se realizaron visitas y se solicitaron préstamos de especímenes en diferentes colecciones entomológicas del país y de Argentina. La identificación y la asociación de ninfas y adultos de las especies, se basó en el levantamiento de caracteres morfológicos, comparaciones con material de las localidades tipo y secuencias de ADN provenientes de regiones de los genes mitocondriales Citocromo Oxidasa I y 12S. Se identificaron 388 especímenes de Haplohyphes aquilonius, 178 de Haplohyphes baritu y 104 de Haplohyphes mithras. A partir de los resultados del trabajo, se registra por primera vez la especie H. baritu para Colombia, la cual se conocía del noroccidente de Argentina y suroccidente de Bolivia. Se amplía el rango de distribución de H. mithras y H. aquilonius para los departamentos de Antioquia, Boyacá, Caldas, Caquetá, Cauca, Huila, Putumayo y Quindío, pertenecientes a la región andina de Colombia. Adicionalmente, se reporta por primera vez la ninfa de H. mitras y se demuestra que las secuencias de regiones de ADN mitocondrial son una herramienta útil para asociación de ninfas y adultos de Haplohyphes.

Palabras clave. Colombia, distribución, efímeras, insectos acuáticos, región andina.

ABSTRACT

With the aim of contributing to the knowledge of the species of Haplohyphes in Colombia , the nymphs and adults of the species of the genus were identified and associated using morphological and molecular characters. To obtain the material and review of the distribution of species in the country, loans of specimens and visits to different collections of the country and Argentina were conducted. For identification and species association of the nymphs and adults, morphological characters were revised, the type species were studied and DNA sequences from regions of two mitochondrial genes (cytochrome Oxidase I y 12S) were considered. Three hundred and eighty eight specimens of Haplohyphes aquilonius, 178 of Haplohyphes baritu and 104 of Haplohyphes mithras were identified. Haplohyphes baritu is recorded for the first time from Colombia , which was previously known only from northwestern Argentina and southwestern Bolivia . Also, the distribution range of H. mithras and H. aquilonius is expanded. Both species are recorded from Departments located in the Andean region of Colombia , namely Antioquia, Boyacá, Caldas, Caquetá, Cauca, Huila, Putumayo. In addition, the nymph of H. mithras was recorded for the first time. It is confirmed that the sequences of mitochondrial DNA constitute a useful tool to associate both adults and nymphs of species of Haplohyphes.

Key words. Colombia , distribution, mayflies, aquatic insects, Andean region.

Recibido:   23/07/2013

Aceptado:  04/04/2014

INTRODUCCIÓN

El orden Ephemeroptera comprende insectos anfibióticos, con destacada importancia en las redes tróficas de los ambientes acuáticos, los cuales han ganado protagonismo en los últimos años como bioindicadores de calidad de agua (Brittain & Sartori 2003, Domínguez et al. 2006, Zúñiga & Cardona 2009, Chará et al. 2010, Meza et al. 2012). Actualmente, el orden está compuesto por cerca de 3000 especies, de las cuales 460 están reportadas para Suramérica (Domínguez et al. 2006).

Leptohyphidae es una de las familias de Ephemeroptera más representativas en el continente americano; distintos autores reconocen entre doce y 18 géneros (Wiersema & McCafferty 2000, Molineri 2006, Dias et al. 2007), entre ellos Haplohyphes de distribución neotropical y representado por seis especies registradas para Centro y Suramérica, de las cuales tres son conocidas solamente para el estado ninfal (Domínguez et al. 2006). El género fue establecido por Allen (1966) para dos especies, H. huallaga Allen (Perú) y H. mithras Traver (Costa Rica), basado en individuos adultos. En 1984, Domínguez describió H. baritu y H. furtiva para el noroccidente de Argentina y por primera vez se conocieron las ninfas del género. Posteriormente, otras dos especies fueron descritas, H. aquilonius por Lugo-Ortiz & McCafferty (1995) con ninfas y H. dominguezi por Molineri (1999) a partir de adultos, para Costa Rica y Ecuador, respectivamente.

En 2003, Molineri describió H. yanahuicsa de Bolivia basado en ninfas y adultos, propuso la sinonimización de H. furtiva con H. baritu, amplió su área de distribución para Bolivia y describió los adultos de esta especie y de H. aquilonius. Adicionalmente, este autor registró por primera vez H. aquilonius y H. mithras para Colombia, región en donde el conocimiento del género es todavía incipiente, con estas dos únicas especies reportadas en diferentes localidades del Valle del Cauca, Risaralda y Nariño (Zúñiga et al. 2004, Domínguez et al. 2006, Dias et al. 2009).

Como fue mencionado anteriormente, las especies de Haplohyphes han sido tradicionalmente descritas basándose en apenas un estado de vida, esto se presenta debido a la dificultad para asociar ninfas y adultos, generalmente realizada mediante la comparación de patrones de coloración y cría. Sin embargo, actualmente existen diferentes técnicas moleculares que utilizan ADN como carácter taxonómico en la asociación de estados inmaduros y adultos de insectos, incluyendo el orden Ephemeroptera (Herbert et al. 2003, Ball et al. 2005, Dias et al. 2011). Considerando lo anterior, el objetivo de este estudio fue contribuir al conocimiento de Haplohyphes en Colombia, a través de la determinación taxonómica de especies y la asociación de ninfas y adultos del género utilizando análisis morfológicos y moleculares.

MATERIALES Y MÉTODOS

Obtención de material. Los ejemplares revisados en el estudio corresponden a diferentes localidades de Colombia, Argentina y Bolivia (Tabla 1), provenientes de la Colección de Insectos Acuáticos del Instituto Biodiversidad Neotropical (IBN) (Tucumán, Argentina); Colección Entomológica del Programa de Biología de la Universidad de Caldas (CEBUC) (Manizales, Colombia); Museo de Entomología de la Universidad del Valle (MUSENUV) (Cali, Colombia); Colección Entomológica de la Universidad de Nariño (PSO) (Pasto, Colombia). El material de Colombia corresponde a colectas comprendidas entre 1991 y 2012 en los departamentos de Antioquia, Boyacá, Caldas, Caquetá, Cauca, Huila, Nariño, Putumayo, Quindío, Risaralda y Valle del Cauca, cuyas localidades están ubicadas en 26 municipios y 53 estaciones de muestreo en corrientes hídricas pertenecientes, en su gran mayoría, a la gran cuenca alta y media del río Cauca (Tabla 1).

Identificación de los especímenes. Para la identificación de las especies se tuvieron en cuenta caracteres morfológicos, moleculares, comparaciones con individuos de cada especie de las localidades tipo, previamente determinados por Molineri (1999, 2003), comparación con descripciones originales de las especies (Allen 1966, Domínguez 1984, Lugo-Ortiz & McCafferty 1995) y claves taxonómicas de Molineri (2003) y Domínguez et al. (2006).

Caracteres morfológicos. Los caracteres diagnósticos utilizados para diferenciar las especies fueron: coloración del estuche alar (en ninfas maduras, pero que todavía no han empezado el proceso de plegado alar), coloración del abdomen, venación de las alas posteriores, genitalia (espina apical del pene, lóbulo membranoso del pene) y fórceps (Molineri 2003, Domínguez et al. 2006). Es importante resaltar que, para este grupo, los patrones de coloración de las pterotecas pueden variar según el instar en que se encuentre la ninfa, lo que usualmente genera alguna incertidumbre en la determinación de las especies del género. Por tal razón, en este estudio además de utilizar caracteres morfológicos para determinar las especies, se complementó con datos moleculares para su confirmación, como ha sido propuesto por diferentes autores (Ball et al. 2005, Dias et al. 2011, García et al. 2011).

Caracteres moleculares. El material utilizado en esta etapa del estudio es mencionado en la Tabla 2.


Cabe resaltar que individuos previamente identificados a nivel de especie fueron utilizados como "control positivo" para probar la efectividad de los marcadores abajo mencionados en la determinación de las especies pendientes de confirmación. La caracterización molecular comprendió las etapas principales de extracción, amplificación y secuenciación de ADN, las cuales se detallan a continuación. La extracción del ADN se realizó con el Kit DNeasy Blood and Tissue de Qiagen, según el protocolo estándar indicado por el fabricante (en el caso de las ninfas, se retiró el aparato digestivo para evitar la contaminación de la muestra). La amplificación del ADN por PCR, se llevó a cabo en 20 μl de mezcla de reacción y contempló la utilización de los genes mitocondriales Citocromo oxidasa I (LCO1490: 5´ GGTCAACAAATCATAAAGATATTGG 3´; HCO2198: 5´ TAAACTTCAGGGTGACCAAAAAATCA 3´) y 12S (12Sai: 5´ AAACTACGATTAGATACCCTATTAT 3´; 12Sbi: 5´ AAGAGCGACGGGCGATGTGT 3´) propuestos por Folmer et al. (1994) y Ogden & Whiting (2005), respectivamente. Los productos de PCR, se purificaron utilizando el kit QIAquick PCR purification (Qiagen) y se enviaron para Macrogen Advancing Through Genomics – Korea para su secuenciación. Las secuencias obtenidas serán enviadas al GenBank®.

En el análisis de datos se utilizaron los programas: Codon Code Aligner (CodonCode Aligner V4.1.1, CodonCode Corporation) para mirar la calidad de las secuencias y Geneious v4.7 (Drummond et al. 2009) para el alineamiento con Muscle. La identificación y confirmación de las especies se realizó mediante la estimación de la similitud entre las secuencias obtenidas a partir de individuos recolectados en diferentes localidades de Colombia, con algunos individuos previamente determinados (control positivo). En el análisis de la similitud se utilizó el programa PAUP v.4.0 (Swofford 2003) bajo el modelo de distancia genética neighbor-joining. Para la elaboración de los mapas de distribución de las especies se utilizó el sistema Geographic Coordinate System: GCS Bogotá, Datum: D Bogotá y el software ESRI® ArcMap 10.0 licencia ArcInfo.

RESULTADOS Y DISCUSIÓN

Distribución de las especies de Haplohyphes en Colombia

En el estudio se identificaron 388 especímenes de H. aquilonius, 178 de H. baritu y 104 de H. mithras (Tabla 1, Figura 1). Se registra por primera vez H. baritu para Colombia, especie que fue descrita originalmente para Argentina y posteriormente para Bolivia (Domínguez 1984, Molineri 2003). Para las especies H. aquilonius y H. mithras, reportadas anteriormente para el Valle del Cauca, Risaralda y Nariño (Molineri 2003, Zúñiga et al. 2004, Dias et al. 2009), se amplía la distribución para la zona andina de ocho nuevos departamentos (Antioquia, Boyacá, Caldas, Caquetá, Cauca, Huila, Putumayo y Quindío, Tabla 1).

Los individuos estudiados presentaron un área de distribución entre 470 y 3100 msnm, información que permite ampliar el rango altitudinal reportada en la literatura para el grupo (entre 500 y 2460 msnm) (Lugo-Ortiz & McCafferty 1995, Domínguez et al. 2006, Molineri 2003). H. aquilonius es el que se presenta a mayor altura, en una localidad del Parque Nacional Natural Los Nevados, que corresponde a zona de subpáramo en la cordillera Central del departamento de Risaralda (3100 msnm), mientras H. mithras se ubica en la menor altura registrada hasta el momento para el género, en una localidad del piedemonte de la cordillera Oriental en el departamento del Caquetá (470 msnm). Cabe destacar que todas las especies identificadas en el trabajo fueron registradas para la región natural andina de Colombia, en las tres cordilleras: Occidental, Central y Oriental (Figura 2, Figura 3 y Figura 4).

A partir de la información disponible en los datos de procedencia de las especies analizadas en las colecciones de Colombia, en cuanto a microhábitat, se observó que la recolección de los ejemplares está asociada principalmente con sustratos rocosos de diferente tamaño, paquetes de hojarasca con detritos retenidos en el lecho del cuerpo de agua y en fondos de tipo arenoso o arcilloso. Domínguez et al. (2006) reportan el género en hábitats similares, excepto en hojarasca, condición nueva observada en Colombia. En general, las corrientes hídricas correspondieron a bajo y mediano orden, la mayoría con buena calidad ambiental de sus aguas, baja carga orgánica residual y niveles de oxígeno disuelto cercanos a la saturación, ubicadas en zonas conservadas o con bajos niveles de intervención antrópica y contaminación orgánica.

Caracterización morfológica

A continuación se presenta la diagnosis de las tres especies de Haplohyphes encontradas.

H. aquilonius Lugo-Ortiz & McCafferty (Figura 1a)

Diagnosis. Imago : 1) alas posteriores con tres venas longitudinales, 2) segmento I del fórceps menor que el segmento II (relación 0.8-0.9), 3) división apical del pene 0.34-0.40, 4) lóbulos membranosos del pene oblicuamente truncados, 5) espinas apicales del pene más cortas que los lóbulos membranosos, 6) longitud del ala anterior del macho: 6.2- 6.5 mm, 7) abdomen sombreado de manera uniforme con gris (similar a la ninfa Figura 1a). En la ninfa: 1) pterotecas anteriores sombreadas de gris en todo el margen costal (Figura 1a), 2) patrón de coloración en la región occipital como propuesto por Molineri (2003). Distribución en el neotrópico: Costa Rica y Colombia. Distribución en Colombia: Antioquia, Boyacá, Caldas, Caquetá, Cauca, Nariño, Putumayo, Quindío, Risaralda y Valle del Cauca (Figura 2)

H. baritu Domínguez (Figura 1b)

Diagnosis. Imago: 1) alas posteriores con tres venas longitudinales, 2) segmento I del fórceps igual o más grande que el segmento II (relación 0.98-1.2), 3) división apical del pene 0.23 a 0.26, 4) lóbulos membranosos del pene oblicuamente truncados, 5) espinas apicales del pene son más cortas que los lóbulos membranosos, 6) longitud del ala anterior del macho mide: 5.0- 7.2 mm, 7) abdomen sombreado de manera uniforme con gris (similar a la ninfa Figura 1a). En la ninfa: 1) pterotecas anteriores sombreadas de gris hasta la mitad del margen costal (Figura 1b), 2) patrón de coloración en la región occipital como propuesto en Molineri (2003). Distribución en el neotrópico: Noroccidente de Argentina, sur occidente de Bolivia y Colombia. Distribución en Colombia: Antioquia, Caquetá, Cauca, Huila, Nariño, Putumayo, Risaralda y Valle del Cauca (Figura 3).

H. mithras (Traver) (Figura 1c)

Diagnosis. Imago: 1) alas posteriores con dos venas longitudinales, 2) segmento I del fórceps igual o más pequeño que el segmento II (relación 0.83-0.96), 3) división apical del pene 0.40, 4) lóbulos membranosos del pene son redondeados, 5) espinas apicales del pene más cortas que los lóbulos membranosos, 6) longitud del ala anterior del macho mide: 3.8 mm, 7) margen posterior de los tergos abdominales sombreados con negruzco (similar a la ninfa Figura 1a). En la ninfa. 1) pterotecas anteriores como en la figura 1c, en ninfas maduras con margen costal casi totalmente negruzco (totalmente negruzco a punto de emerger), 2) margen posterior de todos los tergos abdominales sombreado con negruzco (Figura 1c). Las ninfas de la especie se encuentran en proceso de descripción. Distribución en el neotrópico: Costa Rica y Colombia. Distribución en Colombia: Antioquia, Boyacá, Caldas, Caquetá, Cauca, Huila, Nariño, Risaralda y Valle del Cauca (Figura 4).

Caracterización molecular

De las 28 secuencias de ADN obtenidas, apenas se analizaron 21 (Tabla 2) que presentaban buena calidad (95% - según análisis de Codon Code Aligner), 13 para el gen 12S y 8 para COI. Esto debido a algunas dificultades para amplificar muestras de individuos preservados en alcohol al 70 % y/o en formol, lo que posiblemente está relacionado con lo mencionado por autores como Srinivasan et al. (2002), García et al. (2006) & Villalobos (2006), quienes afirman que el tiempo de fijación de las muestras, además del tipo de solución fijadora, influyen en la calidad del ADN.

Con base en las secuencias de ADN obtenidas de fragmentos de los genes COI y 12S se construyeron dos árboles de similitud (Figura 5 y Figura 6), en donde se compararon los individuos previamente determinados (caracteres morfológicos) con los individuos que estaban pendientes de confirmación (Tabla 2). Los resultados reflejaron la eficiencia de estos marcadores para la determinación de especies de Haplohyphes, ya que los datos moleculares fueron útiles para agrupar individuos (ninfas y adultos) de una misma especie. Gracias al análisis realizado fue posible asociar la ninfa desconocida de H. mithras con su respectivo adulto (Figura 5 y Figura 6). Estos resultados son similares a los encontrados por Hebert et al. (2003), Ball et al. (2005), Gatolliat & Monaghan (2010) y Dias et al. (2011), quienes reconocen que los genes mitocondriales son de gran efectividad para asociar estados de vida y delimitar especies. Adicionalmente, cabe destacar que el gen COI también ha sido ampliamente utilizado para agrupar estados de vida de insectos con una marcada plasticidad fenotípica (Adamowicz et al. 2004, Ball et al. 2005, Williams et al. 2006).

La diferencia observada entre el agrupamiento de las especies en los árboles de similitud (Figura 5 y Figura 6) puede ser explicada por el hecho de que éstos no son una representación de las relaciones de parentesco entre las especies del género, ya que el método utilizado no es apropiado para una inferencia filogenética (Peña 2011). Sin embargo, algunos autores consideran que estos marcadores son muy eficientes en estudios filogenéticos de Ephemeroptera (Ogden & Whiting 2003, 2005), lo que puede ser explorado en futuros estudios de la familia Leptohyphidae.

CONSIDERACIONES FINALES

La información consignada en este trabajo muestra claramente que H. baritu y H. aquilonius a pesar de su gran parecido morfológico pueden seguir siendo tratadas como especies diferentes, extendiéndose considerablemente la distribución de la primera hacia el norte. Además, se manifiesta el amplio rango de distribución geográfico y altitudinal que tienen las tres especies identificadas a la fecha para Colombia, todas ellas ubicadas en la región natural andina. Sin embargo, es importante ratificar la distribución observada mediante colectas en un mayor número de localidades de otras regiones naturales del país, así como también, intensificar el esfuerzo de investigación en la zona andina oriental que es la menos conocida. Por ultimo se resalta la efectividad de las herramientas moleculares para delimitar las especies del grupo y para asociar las ninfas con sus respectivos adultos.

AGRADECIMIENTOS

A la Vicerrectoría de Investigaciones y Posgrados de la Universidad de Caldas por la financiación de la investigación. A todas las instituciones nacionales e internacionales y personas que facilitaron material de estudio, en especial a William Cardona (Fundación Wildlife Conservation Society-Programa Colombia), Marlon Peláez (Universidad de la Amazonía) y Alejandro Villarreal (Universidad del Quindío). Al Museo de Entomología de la Universidad del Valle, Colección Entomológica del Programa de Biología de la Universidad de Caldas, Colección Entomológica de la Universidad de Nariño y la Colección de insectos acuáticos del Instituto de Biodiversidad Neotropical (IBN). A los Laboratorios de Colecciones Biológicas y Biología Molecular de la Universidad de Caldas por el soporte logístico. A Carlos Molineri (Universidad Nacional de Tucumán, Argentina), por su asesoría permanente al proyecto y préstamo de material tipo, a Yeisson Gutiérrez por las fotografías y a Andrés Torres por la elaboración de los mapas de distribución de las especies registradas.

LITERATURA CITADA

1. Adamowicz, S.J., P.D.N. Hebert & M.C. Marinone. 2004. Species diversity and endemism in the Daphnia of Argentina. Zoological Journal of the innean Society 140: 171–204.         [ Links ]

2. Allen, R.K. 1966. Haplohyphes, a new genus of Leptohyphinae (Ephemeroptera: Tricorythidae). Journal of the Kansas Entomological Society 39: 565-568.         [ Links ]

3. Ball, S.L., P.D.N. Hebert, S.K. Burian & J.M. Webb. 2005. Biological identifications of mayflies (Ephemeroptera) using DNA barcodes. Journal of the North American Benthological Society 24: 508-524.         [ Links ]

4. Brittain, J.E. & M. Sartori. 2003. Ephemeroptera (mayflies). En: V.H. Resh & R.T. Cardé (eds.). Encyclopedia of Insects: 373-380. Academic Press, California.         [ Links ]

5. Chará-Serna, A.M., J. Chará, M. del C. Zúñiga, G.X. Pedraza & L.P. Giraldo. 2010. Clasificación trófica de insectos acuáticos en ocho quebradas protegidas de la ecorregión cafetera colombiana. Universitas Scientiarum 15(1): 27-36.         [ Links ]

6. Dias, L.G., C. Molineri & P.S.F. Ferreira. 2007. Ephemerelloidea (Insecta: Ephemeroptera) do Brasil. Papéis Avulsos de Zoologia, MZUSP 47(19): 213-24.         [ Links ]

7. Dias, G.L., M. del C. Zúñiga & T. Bacca. 2009. Estado actual del conocimiento del orden Ephemeroptera (Insecta) en Colombia. En: Memorias. XXXVI Congreso Sociedad Colombiana de Entomología. Simposio sobre Invertebrados: 236- 256. Medellín, Colombia.         [ Links ]

8. Dias, G.L., T. Bacca, L. Navarro, F.E. Acevedo, P.M. Benavides & P.S. Fiuza-Ferreira. 2011. Association of nymphs and adults of Ephemeroptera (Insecta) using the amplified fragment length polymorphism (AFLP) technique. International Journal of Limnology 47: 151-157.         [ Links ]

9. Domínguez, E. 1984. Dos especies nuevas del género Haplohyphes Allen (Ephemeroptera: Tricorythidae) de La Argentina. Revista de La Sociedad Entomológica de Argentina 43 (1-4): 103-112.         [ Links ]

10. Domínguez, E., C. Molineri, M.L. Pescador, M.D. Hubbard & C. Nieto. 2006. Ephemeroptera of South America. In: J. Adis, J.R. Arias, G. Rueda-Delgado & K.M. Wanzen (eds.). Aquatic Biodiversity in Latin America (ABLA).Vol. 2. Pensoft, Sofia-Moscú. 646 pp.         [ Links ]

11. Drummond, A.J., B. Ashton, M. Cheung, J. Heled, M. Kearse, R. Moir, H.S. Stones, T. Thierer & A. Wilson. 2009. Geneious v.4.7 disponible en: http://www.geneious.com (Fecha de revisión: 15 junio 2011).         [ Links ]

12. Folmer, O., M. Black, W. Hoeh, R. Lutz, & R. Vrijenhoek. 1994. DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology 3: 294–299.         [ Links ]

13. García, M., P. Benavente, M.F. Melo, A.A. Roa, E.I. & S.J.C. Roa. 2006. Efecto de la Fijación en la Calidad del ADN: Estudio Controlado con Cinco Fijadores. Revista Española de Patología 39(3): 175-179         [ Links ]

14. García-T, L.F., D.C. Hoyos-J., G.L. Dias, F.A. Rivera & C. Molineri. 2011. Taxonomía del género Haplohyphes Allen (Ephemeroptera: Leptohyphidae). Libro de Resúmenes 38 Congreso Colombiano de Entomología, Socolen. Manizales.         [ Links ]

15. Gattolliat, J.L. & M.T. Monaghan. 2010. DNA-based association of adults and larvae in Baetidae (Ephemeroptera) with the description of a new genus Adnoptilum in Madagascar. Journal of the North American Benthological Society 29:1042-1057.         [ Links ]

16. Hebert, P.D.N, A. Cywinska, S.L. Ball & J.R. Dewaard. 2003. Biological identifications through DNA barcodes. Proceeding Royal Society London Biological Sciences 270: 313-321.         [ Links ]

17. Lugo-Ortiz, C. R. & W.P. McCafferty. 1995. Contribution to the taxonomy of the Leptohyhidae (Insecta: Ephemeroptera) for Central America. Studies on Neotropical Fauna and Environment 30(3): 165-176.         [ Links ]

18. Meza, A.M., J. Rubio, L. Dias & J. Walteros. 2012. Calidad de agua y composición de macroinvertebrados acuáticos en la subcuenca alta del río Chinchiná. Caldasia 34(2): 443-456.         [ Links ]

19. Molineri, C. 1999. Descripción de una nueva especie de Haplohyphes Allen (Ephemeroptera: Leptohyphidae) y clave para separar los imagos machos del género. Acta Zoológica Lilloana 45(1): 29-32.         [ Links ]

20. Molineri, C. 2003. Haplohyphes (Ephemeroptera: Leptohyphidae), new species and stage descriptions with a key to separate the species of the genus. Zootaxa 263: 1-11.         [ Links ]

21. Molineri, C. 2006. Phylogeny of the mayfly family Leptohyphidae (Insecta: Ephemeroptera) in South America. Systematic Entomology 31: 711-728.         [ Links ]

22. Ogden, T.H. & M.F. Whiting. 2003. Phylogeny of Ephemeroptera: molecular evidence. Entomologische Abhandlungen 61(2): 126-127.         [ Links ]

23. Ogden, T. H. & M.F. Whiting. 2005. Phylogeny of Ephemeroptera (mayflies) based on molecular evidence. Molecular Phylogenetics and Evolution 37: 625–643.         [ Links ]

24. Peña, C. 2011. Métodos de inferencia filogenética. Revista Peruana de Biología 18(2): 265 – 267        [ Links ]

25. Srinivasan, M., D. Sedmak & S. Jewell. 2002. Effect of fixatives and tissue processing on the content and integrity nucleic acids. American Journal Pathology 161: 1961-1971.         [ Links ]

26. Swofford, D.L. 2003. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sinauer Associates, Sunderland, Massachusetts.         [ Links ]

27. Villalobos, Q.M.J. 2006. Implementación de un protocolo de extracción de ADN a partir de biopsias humanas y determinación de su calidad para PCR: tesis, Instituto Tecnológico de Costa Rica, Escuela de Biología Ingeniería en Biotecnología.         [ Links ]

28. Wiersema, N.A. & W.P. McCafferty. 2000. Generic revision of the north and central american Leptohyphidae (Ephemeroptera: Pannota). Transactions of the American Entomological Society 126: 337–371.         [ Links ]

29. Williams, H.C, S.J. Ormerod & M.W. Bruford. 2006. Molecular systematics and phylogeography of the cryptic species complex Baetisrhodani (Ephemeroptera, Baetidae). Molecular Phylogenetics and Evolution 40: 370–382.         [ Links ]

30. Zúñiga, M. del C., C. Molineri, & E. Domínguez. 2004. El orden Ephemeroptera en Colombia. En: M.G. Andrade, G. Amad & F. Fernández (eds.) Insectos de Colombia 3: 17-42. Academia Colombiana de Ciencias Exactas, Físicas y Naturales, Bogotá D.C., Colombia.         [ Links ]

31. Zúñiga, M. del C. & W. Cardona. 2009. Bioindicadores de calidad de agua y caudal ambiental: 167-198. En: J. Cantera, Y. Carvajal & L. Castro. (compiladores). Caudal ambiental: conceptos, experiencias y desafíos. Programa Editorial Universidad del Valle, Valle, Colombia.         [ Links ]