SciELO - Scientific Electronic Library Online

 
vol.48 issue4Psychometric validation of the Columbia-Suicide Severity rating scale in Spanish-speaking adolescentsPrediabetes in Colombia: Expert Consensus author indexsubject indexarticles search
Home Pagealphabetic serial listing  

Services on Demand

Journal

Article

Indicators

Related links

  • On index processCited by Google
  • Have no similar articlesSimilars in SciELO
  • On index processSimilars in Google

Share


Colombia Médica

On-line version ISSN 1657-9534

Colomb. Med. vol.48 no.4 Cali Oct./Dec. 2017

https://doi.org/10.25100/cm.v48i4.2858 

Articulo Original

Caracterización de cepas de Acinetobacter spp. resistentes a múltiples fármacos aisladas de unidades de cuidados intensivos en Cali - Colombia

Rómel Fabian Gómez1 

Andres Castillo2 

Mónica Chávez-Vivas3  4 

1 Grupo de Investigación en Microbiología Molecular y Enfermedades Infecciosas (GIMMEIN). Universidad Libre, seccional Cali. Colombia.

2 Departamento de Biología. Facultad de Ciencias Naturales y Exactas. Universidad del Valle, Cali. Colombia.

3 Grupo Microambiente Libre Departamento de Ciencias Biomédicas. Facultad de Salud. Universidad Santiago de Cali. Cali. Colombia.

4 Grupo de Investigación Instituto de Ciencias Biomédicas. Universidad Libre de Cali, Colombia.


Resumen

Introducción:

El uso extensivo de antibióticos ha llevado a la emergencia de cepas multirresistentes en algunas especies del género Acinetobacter.

Objetivo:

Investigar las características moleculares de resistencia a múltiples fármacos de cepas aisladas de Acinetobacter spp. colectadas entre marzo de 2009 y julio de 2010 en 52 pacientes de unidades de cuidados intensivos en Cali - Colombia.

Métodos:

La susceptibilidad a diversas clases de antibióticos se determinó mediante el método de difusión de disco, y la determinación de la especie genómica se llevó a cabo usando un análisis de restricción de ADN ribosómico amplificado (ARDRA) y mediante la secuenciación del gen 16s de ADNr. Además, se analizaron por el método de PCR los genes de las beta-lactamasas, como también, las integrasas IntI1 e IntI2.

Resultados:

La identificación fenotípica mostró que los aislamientos pertenecen principalmente al complejo A. calcoaceticus - A. baumannii. Todos ellos eran multirresistentes a casi todos los antibióticos excepto tigeciclina y sulperazón, y se agruparon en cinco (I a V) antibitipos diferentes, siendo el antibiotipo I el más común (50%). El porcentaje de betalactamasas detectadas fue: blaTEM (17,3%), blaCTX-M (9,6%), blaVIM (21,2%), blaIMP (7,7%), blaOXA-58 (21,2%), blaOXA- 51 (21.2%). El análisis del árbol filogenético mostró que los aislados se agrupaban en A. baumannii (74.1%), A. nosocomialis (11.1%) y A. calcoaceticus (7.4%). Además, el integrón clase 1 y clase 2 se detectaron en 23.1% y 17.3% respectivamente.

Conclusión:

los aislamientos se identificaron principalmente como la especie A. baumanii, y fueron multirresistentes. La resistencia a los betalactámicos puede deberse a la presencia de betalactamasas en la mayoría de los aislamientos.

Palabras clave: Infecciones; Acinetobacter; resistencia; medicamentos; ARN ribosomal 16S; cuidado de la salud.

Abstract

Introduction:

The extensive use of antibiotics has led to the emergence of multi-resistant strains in some species of the genus Acinetobacter.

Objective:

To investigate the molecular characteristics of multidrug-resistant of Acinetobacter ssp. strains isolated from 52 patients collected between March 2009 and July 2010 in medical intensive care units in Cali - Colombia.

Methods:

The susceptibility to various classes of antibiotics was determined by disc diffusion method, and the determination of the genomic species was carried out using amplified ribosomal DNA restriction analysis (ARDRA) and by sequencing of the 16s rDNA gene. Also, the genes of beta-lactamases as well as, integrases IntI1 and IntI2 were analyzed by PCR method.

Results:

The phenotypic identification showed that the isolates belong mainly to A. calcoaceticus- A. baumannii complex. All of them were multi-resistant to almost the whole antibiotics except to tigecycline and sulperazon, and they were grouped into five (I to V) different antibiotypes, being the antibiotype I the most common (50.0%). The percent of beta-lactamases detected was: blaTEM (17.3%), blaCTX-M (9.6%), blaVIM (21.2%), blaIMP (7.7%), blaOXA-58 (21.2%), and blaOXA-51 (21.2%). The phylogenetic tree analysis showed that the isolates were clustering to A. baumannii (74.1%), A. nosocomialis (11.1%) and A. calcoaceticus (7.4 %). Besides, the integron class 1 and class 2 were detected in 23.1% and 17.3% respectively.

Conclusion:

The isolates were identified to species A. baumanii mainly, and they were multiresistant. The resistance to beta-lactams may be by for presence of beta-lactamases in the majority of the isolates.

Keywords: Acinetobacter Infections; Multiple Drug Resistance; 16S Ribosomal RNA; Healthcare Associated Infections

Introducción

Se ha reportado que Acinetobacter spp. está involucrada en infecciones adquiridas en el hospital con una frecuencia creciente 1. El uso extensivo de la quimioterapia antimicrobiana en entornos clínicos ha contribuido a la aparición y diseminación de infecciones nosocomiales por Acinetobacter spp 2. Las especies pertenecientes al complejo A. calcoaceticus- A. baumannii (complejo ACB) son principalmente cepas de Acinetobacter resistentes a antibióticos 3. Este complejo ha sido implicado como la causa de un amplio espectro de enfermedades infecciosas como neumonía, meningitis, bacteriemia, infecciones del tracto urinario e infecciones relacionadas con los dispositivos especialmente en unidades de cuidados intensivos (UCI), y asociadas a altas tasas de mortalidad 4. Debido al fenotipo resistente a múltiples fármacos (MDR, siglas en inglés) del organismo, estas infecciones son difíciles de tratar, lo que incluye resistencia a betalactámicos, aminoglucósidos, fluoroquinolonas y carbapenémicos 5,6. En los últimos años se ha producido un brote nosocomial significativo del complejo complejo MDR ACB en Colombia 7.

La resistencia a los betalactámicos, incluidos los carbapenémicos en el complejo ACB, se debe principalmente a la producción de betalactamasas de espectro extendido (ESBLs), pero también a otros mecanismos, como alteraciones en proteínas de la membrana externa y proteínas de unión a penicilina y aumento de la actividad de las bombas de explusión 8. Tanto las ESBLs, carbapenemasas, como las metalo-beta-lactamasas (MBL) o las oxacilinasas, representan la mayor preocupación debido a la posibilidad de una diseminación rápida 9. Mientras que las MBL encontradas son de tipos IMP y VIM en A. baumannii5, las oxacilinasas presentan cuatro subgrupos principales de OXA que son cromosómicamente localizados como similar a OXA-51 intrínseco; similar a OXA-23 adquirido; similar a OXA-40; y similar a OXA-58 9-12.

La mayoría de los genes que codifican estos ESBLs se encuentran en plásmidos, o en forma de un casete genético en un integrón. Los integrones son elementos genéticos que poseen un sitio de recombinación particular, conocido como attl1, en el cual los genes de resistencia pueden insertarse mediante recombinación sitio específica en forma de casetes de genes 13. Se han descrito diferentes clases de integrones, y las clases 1, 2 y 3 se han asociado con resistencia a antibióticos 13,14. La diseminación de estos integrones de resistencia a antibióticos, que no pueden promover su movilización, está principalmente relacionada con transposones y plásmidos. Se han publicado diferentes informes que identifican a los integrones como responsables de la presencia y adquisición de resistencia a antibióticos en A. baumannii13,14. Hay datos limitados sobre la epidemiología global de A. baumannii en nuestra región. Sin embargo, la distribución del integrón de clase 2 es muy frecuente en aislamientos clínicos de A. baumannii de Argentina, Chile y Brasil 14,15.

Los objetivos del presente estudio fueron analizar las características fenotípicas y moleculares del complejo de ACB y la resistencia a antibióticos en aislados clínicos en un hospital colombiano de atención terciaria. Además de determinar los perfiles de resistencia antimicrobiana de las cepas aisladas. También se comprobó la presencia de MBL o ESBL en Acinetobacter spp.

Para probar la hipótesis de que la mayoría de los genes que codifican MBL o ESBL se encuentran en los casetes génicos de los integrones, se examinaron por PCR, en aislados representativos, la presencia de los integrones de clase 1 y clase 2 y los genes asociados a resistencia antimicrobiana. El conocimiento sobre la epidemiología y los mecanismos moleculares de la resistencia a los antimicrobianos en este importante patógeno es esencial para implementar estrategias de intervención.

Materiales y Métodos

Se llevó a cabo un estudio descriptivo respaldado por el comité de ética del hospital.

Muestras clínicas de cepas bacterianas

El estudio incluyó 52 cepas de Acinetobacter spp obtenidas de muestras clínicas, previamente identificadas por la tarjeta Vitek GNI (bioMeriex Vitek Inc., Hazelwood, MO), que crecieron en agar MacConkey estándar a 37 °C durante 48 h, entre marzo de 2009 y julio de 2010 de una unidad de cuidados intensivos médicos en el Hospital Universitario Rafael Uribe Uribe de Cali - Colombia. Las muestras clínicas se obtuvieron de: Rastreo nasal, 24 (46.2%); heridas, 12 (26.1%); punta del catéter, 6 (11.6%); el tracto urinario, 6 (11.6%); y sangre, 4 (7.7%). Todas las muestras se almacenaron a -80 °C en caldo nutritivo con 15% de glicerol. De las 52 cepas aisladas de Acinetobacter spp, se obtuvieron 24 (46.2%).

Prueba de sensibilidad antimicrobiana

La susceptibilidad a varias clases de antibióticos se determinó mediante el método de difusión de disco en un agar Mueller-Hinton (MH) (Difco Laboratories, Detroit, MI, EE. UU.), según las directrices del Instituto Clínico y de Laboratorio Estándar (CLSI) 16. Ambas cepas, Acinetobacter baumannii (ATCC® 19606 ™) y Escherichia coli (ATCC® 25922 ™) se usaron como cepas de control de calidad. Los discos de antibióticos (Oxoid®) probados fueron los siguientes: trimetroprima/sulfametoxazol (SXT, 23.75 μg/1.25 μg); ticarcilina/clavulanato (TIM, 75 μg/10 μg); gentamicina (GEN, 10 μg); tobramicina (TOB, 10 μg); ciprofloxacina (CIP, 5 μg); ceftazidima (CAZ, 30 μg); cefepime (FEP, 30 μg); aztreonam (ATM, 30 μg); imipenem (IMP, 10 μg); meropenem (MEM, 10 μg); ampicilina/sulbactam (SAM, 10 μg/10 μg); amikacina (AMK, 10 μg); cefoprazona/sulbactam (sulperazona, SUL, 75 μg/30 μg); y tigeciclina (TIG, 15 μg). De acuerdo con Manchanda et al.17 se definió Acinetobacter spp. MDR si los aislados son resistentes a tres antibióticos diferentes a la ceftazidima, como ciprofloxacina, gentamicina e imipenem.

Identificación de aislados de Acinetobacter spp.: Análisis de Restricción de ADN Ribosomal Amplificado (ARDRA)

La especie genómica de Acinetobacter spp. fue determinada por ARDRA, de acuerdo con Vaneechoutte et al18. En resumen, el ADN de un cultivo de una noche en caldo LB a 37°C fue extraído utilizando el kit "Easy-DNATM" (Invitrogen, life technologies ®) de acuerdo con las instrucciones del fabricante. Después de la electroforesis, el gel se tiñó con bromuro de etidio (1.5 μg/mL) y se analizó en un FOTO/Analyst® Investigator/FX Systems (FOTODYNE Incorporated). Para cada muestra, la reacción de PCR se realizó para la amplificación del gen 16s ADNr utilizando el siguiente par de cebadores: Acf5'-TGG CTC AGA TTG AAC GCT GGC GGC-3'y Acr5'-TAC CTT GTT ACG ACT TCA CCC CA-3'. Los productos de PCR se digirieron con las siguientes enzimas: CfoI; Alu; Mbo; y MspI (Fermentas ™) y separados por electroforesis en gel de poliacrilamida (PAGE 8.0%).

Los últimos perfiles de restricción se compararon con la base de datos de la biblioteca de cepas (http://users.ugent.be/~mvaneech/ARDRA/Acinetobacter.html) para identificar la especie de acuerdo con Dijkshoorn et al19. La cepa de A. baumannii (ATCC® 19606 ™) se usó como control.

Identificación de aislados clínicos de Acinetobacter spp. mediante PCR-secuenciación del gen 16s ADNr

Se purificaron 27 productos de PCR para el gen 16s ADNr, usando el kit "High Pure PCR Purification Kit Version 20, de acuerdo con las instrucciones de la compañía (Roche Applied Science®) y luego, cada producto de PCR purificado se secuenció directamente mediante el método dideoxi de Sanger usando un Secuenciador ABI 3730XL. Las secuencias de 16S ADNr se alinearon con 27 secuencias de referencia de Acinetobacter albergadas en la base de datos GenBank-NCBI.

El árbol filogenético se realizó utilizando el software MEGA v.5 bajo el modelo de Máxima Verosimilitud con los parámetros Kimura-2, y la distribución Gamma asumiendo sitios invariables (K2 + G + I). La robustez del árbol filogenético se calculó mediante un bootstrap no paramétrico con 1,000 réplicas 20,21. Se utilizó una secuencia de Staphylococcus aureus como grupo externo.

Detección de genes de ESBL por PCR

Genes de ESBL, tales como blaTEM; blaSHV; blaOXA; blaCTX-M; blaIMP; y blaVIM, se detectaron por PCR usando los cebadores enumerados en la Tabla 1 22-30. El volumen final de la reacción de PCR fue de 50 μL con 5-10 ng (ADN genómico) buffer de reacción, 1 U de Taq polimerasa (Bioline, Londres, Reino Unido), 200 μM para cada desoxinucleósido trifosfato, 1.5 o 2.5 mM MgCl2, 10 pmol de cada primer. La temperatura del termociclador fue de 94° C durante 5 min; 94° C durante 30 s por 35 ciclos. Para blaTEM, 52° C durante 45 s; blaOXA-51 y blaOXA-58, 62° C durante 1 minuto; blaCXT-M, 51° C durante 45 segundos; blaVIM y blaIMP 51° C durante 1 min; y 72° C durante 60 s. Una etapa final de 10 min a 72° C.

Tabla 1: Cebadores usados en el estudio 

Cebador Secuencia de oligonucleotidos Tamaño (bp) Referencia
rDNA16S AC F-5’_TGGCTCAGATTGAACGCTGGCGGC_3’ 1,500 18
R-5’_TACCTTGTTACGACTTCACCCCA_3’
blaTEM F-5´_ATGAGTATTCAACAT TTCCG_3´ 956 23
R-5´_CTGACAGTTACCAATGCTTA_3´
bla VIM F-5´_AAAGTTATGCCGCACTCACC_3´ 865 24
R-5´_TGCAACTTCATGTTATGCCG_3´
bla IMP F- 5´_ATGAGCAAGTTATCCTTATTC_3´ 741 25
R- 5´_GCTGCAACGACTTGTTAG_3´
blaCTX-M-9 F -5´_GTGACAAAGAGAGTGCAACGG_3´ 856 26
R-5´_ATGATTCTCGCCGCTGAAGCC_3´
blaOXA-51 F-5´_CGGAGAACGACTCCTCATTAAAAA_3´ 431 27
R-5´_TTTAGCTCGTCGTATTGGACTTGA_3´
blaOXA-58 F-5´_AAGTATTGGGGCTTGTGCTG_3´ 599 28
R-5´_CCCCTCTGCGCTCTACATAC_3´
Int1 F-5´_CAGTGGACATAAGCCTGTTC_3´ 160 29
R-5’_CCCGAGGCATAGACTGTA_3´
Int2 F-5´_TTGCGAGTATCCATAACCTG_3´ 288 29
R-5´_TTACCTGCACTGGATTAAGC_3´
CS R-5´_GGCATCCAAGCAGCAAG_3´ Variable 29
F-5´_AAGCAGACTTGACCTGA_3´
hep35 R-5´_TGCGGGTYAARGATBTKGATTT_3´ 491 30
hep36 F-5´_CARCACATGCGTRTARAT_3´

Detección de genes de integrasa por PCR

Los genes de la integrasa clase 1 (intI) y 2 (intII) se amplificaron como se describió previamente 15,30. La amplificación para cada uno se realizó en volúmenes de 50 μL usando 5-10 ng (ADN genómico) de buffer de reacción, 2 U de polimerasa Taq (Bioline, Londres, Reino Unido), 200 μM para cada desoxinucleósido trifosfato, 2,0 mM de MgCl2, 10 pmol de cada cebador. Las condiciones de PCR fueron las siguientes: un inicio con choque de calor a 94 °C durante 5 min; 35 ciclos de 30 s a 94 °C, 30 s a 55 °C; y un paso final de 10 min a 72 °C.

La mezcla de reacción para los cebadores degenerados hep35 y hep36 eran equivalentes a los anteriores excepto por la concentración de cada cebador (2.0 μM) y para los pasos de extensión de la PCR (72º C y 2 min).

Análisis estadístico

Los datos se analizaron usando Stata versión 11.0 (Stata Corp, College Station, Tex). Las variables categóricas se analizaron mediante la prueba χ2. Todas las pruebas fueron de dos colas con p <0.05 considerado significativo.

Resultados

Susceptibilidad a antibióticos

Los antibióticos probados por el método de difusión en disco mostraron resistencia múltiple a una amplia gama de antibióticos. La mayoría de los aislamientos de Acinetobacter spp. fueron resistentes a trimetoprima / sulfametoxazol, gentamicina, amikacina, tobramicina, ticarcilina/ácido clavulánico, cefepime, ceftazidima e imipenem con tasas de resistencia del 100%; mientras presentaban susceptibilidad variable a ciprofloxacina (51/52, 98.1%), levofloxacina (45/52, 86.5%), ampicilina-sulbactam (49/52, 94.2%) y meropenem (50/52, 96.2%). Los agentes antimicrobianos a los que las cepas de Acinetobacter spp fueron más susceptibles fueron la tigeciclina y la sulperozona. Por el contrario, el 21.2% (11/52) y el 28.8% (15/52) de ellos fueron resistentes a tigeciclina y sulperozona, respectivamente. Además, todos los aislamientos fueron resistentes a al menos tres clases de antibióticos (imipenem o meropenem, amikacina o tobramicina y cefalosporinas de espectro extendido), cumpliendo así los criterios de resistencia a múltiples fármacos 17. Es de resaltar, que de los aislamientos distribuidos en julio y septiembre de 2009, 10 aislamientos (19.3%) se consideraron Pan resistente a las drogas (PDR) de acuerdo con Falagas et al.31, demostrando resistencia a todos los antibióticos probados en este estudio.

Un antibiótico común en cepas no relacionadas de co-circulación

Dependiendo de sus susceptibilidades a 14 diferentes fármacos antimicrobianos, los 52 aislamientos del complejo ACB se agruparon en cinco (I a V) antibiotipos diferentes. La mayoría de los aislamientos pertenecientes al antibiotipo I (50.0%), con menos aislados pertenecientes al antibiotipo IV (19.3%), antibiotipo II (17.3%) y antibiotipo V, con solo 1.9% de todos los aislados. Curiosamente, los aislados pertenecientes al antibiótipo I eran susceptibles a tigeciclina y sulperozona, y la mayoría de los aislados clínicamente significativos se encontraban en rastreo nasal (57.7%), seguidos de heridas y puntas de catéter (23.1% y 15.4%, respectivamente) (p <0.05) (Tabla 2). Del antibiotipo I, veinticinco aislados fueron recolectados entre junio y noviembre de 2009 y solo se detectó un aislado en mayo de 2010.

Tabla 2 Antibiotipos del complejo A. baumannii-calcoaceticus aislados del sitio de muestreo, perfiles de resistencia y susceptibilidad 

Antibiotipo Aislados n (%) Sitio de muestra Perfil de resistancIA Perfil de susceptibilidad
MN n (%) San n (%) PC N (%) He n (%) Or n (%) SU n (%)
I 26 (50.0) 15 (57.7) 1 (3.8) 4 (15.4) 6 (23.1) - - AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM TIG, SUL
II 9 (17.3) 6 (66.7) - 2 (22.2) - 1 (11.1) - AMK, GEN, TOB, CIP, SXT, TIC/AC, FEP, CAZ, IMP TIG, SUL/ LVX, SAM o MEM
III 6 (11.5) 1 (16.7) 2 (33.3) - 1 (16.7) 2 (33.3) - AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM TIG ó SUL
IV 10(19.3)* 2 (20.0) - - 5 (50.0)** 1 (10.0) 2 (20.0) AMK, GEN, TOB, CIP, LVX, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM, TIG, SUL -
V 1 (1.9) - 1 (100) - - - - AMK, GEN, TOB, SXT, SAM, TIC/AC, FEP, CAZ, IMP, MEM TIG, SUL, CIP, LVX
Total 52 (100) 24 (46.2) 4 (7.7) 6 (11.5) 12 (23.1) 4 (7.7) 2 (3.8)

El antibiotipo IV agrupó significativamente los aislados de PDR (19.3%) (p <0.05) y se detectó con mayor frecuencia en heridas (50%; OR = 5.000; p = 0.025). Este antibiotipo se detectó por primera vez en marzo de 2009 y apareció nuevamente en julio, agosto y noviembre del mismo año, así como en abril, mayo y junio de 2010. Como se muestra en la Tabla 2, 27 aislamientos de A. baumannii (37.1%) exhibieron cinco antibiotipos distintos. Doce de los aislados (54.5%) se clasificaron como antibiotipo I, dos (9.1%) aislados para antibiotipo III, cuatro (18.2%) aislamientos para antibiotipo IV y un (5.0%) aislado para antibiotipo V. Cuatro cepas de A. calcoaceticus revelaron dos antibiotipos distintos, y tres cepas de 13TU mostraron tres antibiotipos diferentes.

Identificación de aislados de Acinetobacter spp

La identificación genómica de 52 cepas pertenecientes al complejo ACB se realizó mediante el método ARDRA y secuenciación (Tabla 3 y 4). Los resultados revelaron que 23 (44.2%) aislamientos tenían el perfil combinado "1 1 1 2 3" o "1 1 1 2 1" para las diversas enzimas CfoI, AluI, MboI, RsaI y MspI. De acuerdo con la biblioteca de referencias, las cepas de perfiles identificaron los organismos como especies 2 (A. baumannii), tres (5.8%) fueron A. nosocomialis (13TU), dos fueron A. calcoaceticus y dos fueron A. pitti (genospecies 3).

Para el análisis NCBI-BLAST, se consultaron 27 cepas utilizando secuencias de un fragmento de 1,500 pb del ADNr 16s. Esta identificación de todos los aislados clínicos a nivel de especie mostró que todos los amplicones tenían una concordancia de secuencia de 61 a 99% 32.

Tabla 3 Distribución y caracterización molecular de aislados del complejo A. baumannii-calcoaceticus

Código Sitio de muestreo Antibiotipo Genes Bla Integron
OXA-51 TEM CTXM-9 VIM-2 IMP-1 OXA-58
5790341 Muestra nasal 1 +
5793548 Muestra nasal 1 + + +
21262 Orina 2 +
5701177 Herida 1 + + +
1 Herida 4 + + +
5793546 Muestra nasal 1 + + +
5702062 Muestra nasal 2 +
5701373 Herida 1 + + + +
5704225H Herida 4 + +
5717479 Muestra nasal 1 +
5718164 Muestra nasal 2 + + +
21311 Herida 1 + +
5728549 Herida 3 + + +
21499 Muestra nasal 1 + +
5730330 Punta cateter 1 + + +
5748866 Sangre 5 +
5749428 Muestra nasal 1 + + +
5761126 Punta Cateter 1 + +
5750598 Secreción uretra 4 + +
5723185 Muestra nasal 1 + +
2513 Orina 3 + + + +
5759531 Muestra nasal 4 + + + +
209021(13TU) Muestra nasal 3 +
5725011 (13TU) Muestra nasal 2 + +
5717971 (13TU) Muestra nasal 1 + + +
Ab3 (A. calcoaceticus) Herida 1 + + +
5701789 (A. calcoaceticus) Muestra nasal 4 + +
5701372 (A. calcoaceticus) Muestra nasal 1
85.7% 21.4% 10.7% 25.0% 10.7% 53.6% 28.6%

Tabla 4 Perfiles obtenidos por analisis de restriccion de genes amplificando rRNA del complejo A. baumannii-calcoaceticus 

No. Secuencia genotipo Perfil ARDRA Aislados Enzimas
CfoI AluI MboI MspI
1 AB AB 5704225H 1 1 1 1
2 AB AB Ab19606 1 1 1 1
3 AB AB 2513 1 1 1 1
4 AB AB 5748866 1 1 1 1
5 AB AB 5790341 1 1 1 1
6 AB AB 5730330 1 1 1 1
7 AB AB Ab21499 1 1 1 1
9 AB AB Ab21311 1 1 1 1
10 AB AB 5728549 1 1 1 1
11 AB AB 5717479 1 1 1 1
12 AB AB 5793538 1 1 1 1
13 AB AB 5761126 1 1 1 1
14 AB AB 5702062 1 1 1 1
16 AB AB 21262 1 1 1 1
17 AB AB Ab1 1 1 1 3
18 AB AB 5701177 1 1 1 3
19 AB AB 5759531 1 1 1 3
20 AB AB 5750598 1 1 1 3
21 13TU AB 209021 1 1 1 1
22 13TU AB 5725011 1 1 1 1
23 13 TU AB 5717971 1 1 1 3
24 UD AB 5704581 1 1 1 1
25 Calcoaceticus 13TU 5701372 2 1 1 3
26 Calcoaceticus 13TU 5701789 2 1 1 1
27 UD 13TU 5748623 2 1 1 1
28 AB 3U 5793546 2 1 3 3
29 UD 3U 5738406 2 1 3 1
30 UD UD NAC51 2 2 4 1

Los perfiles de resistencia fueron: Calcoaceticus=A. calcoaceticus (2 2 1 3); AB= A. baumannii (1 1 1 1 / 1 1 1 3); 3U= Acinetobacter 3U (2 1 3 3); A. haemolyticus (1 4 1 2); 13TU= Acinetobacter 13TU (2 1 1 1 / 2 1 1 3); UD= indefinido

En la Figura 1, se muestra el árbol filogenético de las genoespecies de Acinetobacter mediante el análisis de secuenciación del ADNr 16s. De todos los aislamientos, el 74.1% (20/27) se agruparon con A. baumannii mientras que A. nosocomialis constituyó el 11.1% (3/27) del total. Los métodos moleculares (ARDRA y análisis de secuencia) aplicados en este estudio nos permitieron discriminar dentro del complejo ACB cada una de las especies que lo componen. Sin embargo, encontramos ambigüedad entre los dos métodos al definir las genoespecies A. calcoaceticus, Acinetobacter 3U, Acinetobacter 13U como se muestra en la Tabla 4.

Figura 1 Árbol filogenético de Acinetobacter genospecies por análisis de secuenciación de rDNA 16s. En total, 27 aislados clínicos se compararon con las secuencias de Acinetobacter 16s rDNA16 informadas en el GenBank-NCBI. El árbol filogenético se realizó utilizando el software MEGA v.5 bajo el modelo de Máxima Verosimilitud con los parámetros Kimura-2, y la distribución Gamma asumiendo sitios invariables (K2 + G + I). La robustez del árbol filogenético se calculó mediante un bootstrap no paramétrico con 1,000 réplicas. 

Caracterización molecular de genes de ESBL

Todos los aislados productores de ESBL en el complejo ACB se sometieron a experimentos de PCR para detectar los genes ESBL, que incluyen blaTEM, blaSHV, blaCTX-M, blaOXA-51, blaOXA-58, blaVIM y blaIMP. Treinta y nueve aislamientos (75.0%) portaban varios genes bla (hasta dos genes).

La amplificación por PCR de los genes de beta-lactamasa de clase A reveló que el 17.3% (9/52) de los aislados contenían blaTEM-1 y cinco (9.6%) aislados contenían blaCTXM-9, mientras que blaOXA-58 se encontró significativamente en todas cepas de A. baumannii resistentes a carbapenem (p <0.05). El gen blaTEM-1 se identificó en cuatro aislados de A. baumannii y un aislado de A. calcoaceticus. El gen blaCTXM-9 se detectó en dos aislados de A. calcoaceticus y un aislado de 13TU, el gen blaOXA-58 se detectó en un aislado de A. baumanni, dos aislados de A. calcoaceticus y un aislado de 13TU. Todos los aislamientos de A. baumannii fueron positivos para genes similares a blaOXA-51. La PCR no detectó los genes blaOXA-23 y blaSHV.

Entre los aislamientos productores de MBL en el complejo ACB, blaVIM-2 y blaIMP-1 se encontraron en 21.2% y 7.7% de los aislamientos, respectivamente. En 30.0% de las cepas de A. baumannii se detectó el gen blaVIM-2, y todas se obtuvieron de rastreos nasales.

Detección de integrones por PCR

La detección por PCR de los genes intl1, intl2 e integrasa demostró la presencia de integrones en las especies de Acinetobacter aisladas. La PCR realizó la determinación del tamaño de cualquier casete de gen insertado dentro del genoma. En general, la PCR del gen de la integrasa dio como resultado una frecuencia de aislamientos positivos para el integrón del 38.5% (20/52) con diversos tamaños de insertos dentro del complejo ACB, de acuerdo con estudios previos que informaron una alta frecuencia de gramnegativos multirresistentes aislados que contienen integrones 13-15,25,30.

Los integrones de clase 1 se encontraron en el 23.1% (12/52) de los aislamientos del complejo ACB. La longitud de los amplicones de las regiones variables oscilaba entre 0.75 y 2.5 kb; 0.75 kb (13.0%), 2.5 kb (5.0%) y (0.75 + 2.5 kb) (7.0%). Adicionalmente, la PCR podría ser útil para determinar sus surtidos de casete genético. La mayoría de los aislamientos con integrones pertenecientes al antibiotipo I se encontraron en rastreos nasales y heridas. El gen intI2 de los integrones de clase 2 se detectó en el 17.3% (9/52) de los aislados. La presencia de integrones de clase 2, en seis aislamientos, que también contenían un integrón de clase 1 fue estadísticamente significativa (p <0.05%).

Se detectaron integrones de clase 1 y 2 en dos aislados pertenecientes a los antibiotipos I y IV con los genes blaTEM-1 y blaOXA. Además, los aislados pertenecientes a los antibiotipo II y III también contenían integrones. Por el contrario, no se encontraron cepas con integrasa positiva en el antibiotipo V.

Los integrones se encontraron en 30.4% (7/23) aislados de A. baumannii. Se detectaron integrones de clase 1 en 26.1% (6/23) de los aislamientos de A. baumannii, mientras que solo una cepa de A. baumannii contenía un integrón de clase 2 (Tabla 3). Los integrones se detectaron en cuatro aislamientos de A. baumannii (13.6%) obtenidos de rastreos nasales, dos (9.1%) de las heridas y uno (4.5%) de las vías urinarias, aunque la asociación no fue estadísticamente significativa (p <0.05). Además, los aislamientos de A. baumannii positivos para el integrón contenían los genes blaTEM-1 y blaVIM-2.

Discusión

Se han notificado infecciones nosocomiales por A. baumannii en todo el mundo 5,33. Sin embargo, hay poca información sobre el comportamiento epidemiológico de los aislados que circulan en la ciudad de Cali. En este sentido, la disponibilidad de 52 aislados nosocomiales ha ofrecido la oportunidad de evaluar los perfiles de susceptibilidad, los determinantes de la resistencia a los antibióticos y sus mecanismos de resistencia. La mayoría de los aislamientos del complejo ACB fueron más frecuentes en el rastreo nasal (46.2%) y de éstos, el 63.6% corresponde a A. baumannii en pacientes ingresados ​​en la UCI. Este hallazgo es significativo porque la colonización nasal en pacientes mayores de 65 años con enfermedad pulmonar preexistente o cualquier enfermedad debilitante, especialmente en la UCI, tiene un mayor riesgo de desarrollar infecciones asociadas a la atención médica (IAH) 34,35.

Por otro lado, preocupa que los 52 aislamientos fueran multi-resistentes a los antibióticos, y la tigeciclina y sulperazona fueran las únicas que mantuvieron la actividad antimicrobiana contra la mayoría de los aislados evaluados (80.0%). Además, se identificaron aislamientos de PDR (19.3%), con un valor estadísticamente significativo (p≤0.05), un resultado similar al reportado por algunos autores en Brasil en los mismos años de este estudio, donde se encontraron aislamientos con esta característica en 11% 31.

En Colombia, la resistencia informada en A. baumannii ha aumentado en los últimos años. Específicamente, en Bogotá entre los años 2001 y 2008, hubo cepas aisladas sensibles a carbapenémicos, quinolonas, y a cefalosporinas de última generación y aminoglucósidos en el 30% de los casos 36. Además, Pinzon et al. (37, para ese mismo año, reportó cepas sensibles a carbapenémicos (35.8%); sin embargo, en 2012, el número de aislamientos con resistencia a carbapenémicos aumentó, en más del 90% 38.

En 2009, la PAHO informó en los países de América Latina porcentajes de resistencia a carbapenem por encima del 70%, y resultados similares en el comportamiento de la resistencia a los aminoglucósidos, trimetoprim-sulfametoxazol en varios países de América Central y del Sur 39.

Los informes de SENTRY en países de América Latina, Europa y los Estados Unidos indican que Acinetobacter spp. presenta altas tasas de resistencia incluso al carbapenem. Un estudio multicéntrico realizado por Higgins et al. (33, en el año 2010 mostró que el 100% de los aislamientos de A. baumannii eran resistentes a imipenem, lo que coincide con los datos obtenidos en este estudio durante el mismo período. Todos los complejos ACB aislados fueron resistentes a múltiples fármacos, incluidos los aislados de A. baumannii, con porcentajes de resistencia a carbapenem en más del 96%, lo que muestra un aumento en la resistencia a los antibióticos en los últimos años. Estos hallazgos son inquietantes porque los nuevos agentes antibacterianos desarrollados, como el doripenem, el ceftobiprol y la ceftarolina, no muestran actividad contra A. baumannii resistente a cefalosporinas y carbapenémicos 40. Boo et al.41, plantean la posibilidad de que se produzca una co-selección de cepas resistentes a carbapenémicos mediante la adquisición de carbapenemasas de tipo OXA de clase D. Nuestro estudio demostró que todos los aislamientos de A. baumannii presentaban la capacidad de hidrolizar cefalosporinas de amplio espectro (ceftazidima y cefepima) y carbapenémicos (imipenem y meropenem). Detectamos la presencia de beta-lactamasa tipo OXA-51 y OXA-58, lo que explicaría la resistencia tan marcada al carbapenem, reportado de manera similar por Gales et al42.

Este estudio demostró la escasa capacidad de identificación de especies de Acinetobacter por el sistema Vitek-2 GNI. Resalta la necesidad de considerar tales resultados como datos preliminares. La identificación precisa mediante métodos moleculares no solo es importante en la investigación de los brotes causados ​​por especies de Acinetobacter, sino que también es relevante en estudios epidemiológicos como este informe. Nuestros resultados son similares a los informes publicados en otras regiones geográficas 43 y coinciden con los informes de Karageorgopoulos et al.44, que encontró sensibilidad a la tigeciclina inferior al 90% de los aislamientos de Acinetobacter spp. Lo anterior, lo convierte en una opción de tratamiento potencialmente útil contra bacterias altamente resistentes; sin embargo, algunas de estas bacterias también presentan resistencia a la tigeciclina.

Dentro de aislamientos multirresistentes del complejo ACB y los de A. baumannii, se detectó bla (TEM-1, CTX-9, OXA-58, IMP-1 y VIM-2). Aunque la presencia de la beta-lactamasa TEM-1 se informa como una de las principales causas de resistencia a los antibióticos beta-lactámicos en los aislados de A. baumannii, en este estudio, solo el 22.7% de los aislados fueron portadores del gen blaTEM- 1. En los últimos años, la tendencia ha cambiado; el aumento de la resistencia a los carbapenémicos se debe principalmente a la presencia de metalo-beta-lactamasas y carbapenemasa tipo OXA de clase D, cuya sobreexpresión está regulada por la presencia de elementos de inserción aguas arriba, como ISAba1 11.

En este estudio, el 38.5% de los aislados de complejo ACB y el 50.0% de A. baumannii presentaron beta-lactamasas tipo OXA-58. A pesar de eso, algunos informes han sugerido que los genes de beta-lactamasas tipo OXA se transportan en integrones 37,38, nuestros resultados mostraron que el 82% de los aislamientos del complejo ACB y A. baumannii que contenían estos genes no mostraron relación con integrones. Estos resultados son consistentes con los informados por Poirel et al.45, quien dijo que estos genes no se encuentran generalmente en forma de casetes de genes y, según el mismo autor, estos genes se transportan en plásmidos o están asociados con un proceso de recombinación homóloga.

La presencia de integrones (clase 1 y 2) en el 40% de los aislamientos fue estadísticamente significativa; ambas clases de integrones se han descrito entre los miembros del género Acinetobacter aislados tanto en entornos clínicos como medioambientales 14. Se informa que las cepas epidémicas de A. baumannii tienden a contener un mayor número de integrones que no son epidémicos, y afirma que el uso de antibióticos tiene un gran impacto en el desarrollo de la diversidad y el mantenimiento de estas cepas en la UCI 46.

El integrón de clase 1 presenta múltiples casetes, lo que confiere resistencia a varios antibióticos, como un sello fenotípico distintivo en los aislados de A. baumanni13-15,30, lo que explicaría la resistencia a múltiples fármacos detectada en aislamientos del complejo ACB y A. baumannii. La integración de estos elementos en el cromosoma bacteriano puede afectar la expresión de genes como blaOXA-51, que codifica un Amp c, b, y la carbapenemasa cromosómica. En este estudio, los 22 aislamientos de A. baumannii mostraron resistencia a cefalosporinas y carbapenémicos; sin embargo, solo el 25% de ellos detectaron integrones dentro del genoma. Del complejo ACB, en 32 aislamientos no fueron detectados integrones, por lo que la resistencia a múltiples antibióticos en estos aislamientos debe relacionarse con otros mecanismos de resistencia que pueden ser mediados por plásmidos o mediante la reducción de la permeabilidad membrana celular o de la pared 47. El mayor número de integrones se detectó en aislamientos obtenidos por rastreo de muestras nasales y heridas quirúrgicas. Estos resultados no concuerdan con los obtenidos por Koleman et al.29, mientras que el mayor número de integrones se detectó en aislados de sangre y secreciones; esta discrepancia probablemente se deba a la mayor cantidad de aislados de este estudio que se obtuvieron a partir de la colonización nasal y la ausencia de infecciones.

Agradecimientos:

Agradecemos a la Clínica Universitaria Rafael Uribe Uribe por permitirnos realizar este estudio con aislamientos clínicos de sus pacientes, a CIDEIM (Centro Internacional de Entrenamiento e Investigaciones Médicas) por la cepa 3386 de Pseudomonas aeruginosa utilizada como control y a la Universidad Libre Seccional Cali por financiar este estudio

REFERENCIAS

1. Peleg AY, Seifert H, Paterson DL. Acinetobacter baumannii: Emergence of a Successful Pathogen. Clin Microbiol Rev. 2008; 21:538-82. [ Links ]

2. Maragakis LL, Perl TM. Acinetobacter baumannii: Epidemiology, Antimicrobial Resistance and Treatment Options. Clin Infect Dis. 2008; 46:1254-63. [ Links ]

3. Scott P, Deye A, Srinivasan C, Murray K, Moran E, Hulten J. et al. An outbreak of multidrug-resistant Acinetobacter baumannii-calcoaceticus complex infection in the US military health care system associated with military operations in Iraq. Clin Infect Dis. 2007; 44:1577-84. [ Links ]

4. Sunenshine R, Wright L, Maragakis AD, Harris X, Song J, Hebden SE. et al. Multidrug-resistant Acinetobacter infection mortality rate and length of hospitalization. Emerg Infect Dis. 2007; 13:97-103. [ Links ]

5. Perez F, Hujer AM, Hujer KM, Decker BK, Rather PN, Bonomo RA. Global challenge of multidrug-resistant Acinetobacter baumannii. Antimicrob Agents Chemother. 2007; 51: 3471-84. [ Links ]

6. Ledeboer N, Hodinka R. Molecular detection of resistance determinants. J Clin Microbiol. 2011; 49 (9 Suppl): S20-S24. [ Links ]

7. Saavedra SY, Nuñez JC, Pulido IY, González EB, Valenzuela EM, Reguero MT, et al. Characterization of carbapenem resistant Acinetobacter calcoaceticus-A. baumannii complex isolates in a third level hospital in Bogotá, Colombia. Int J Antimicrob Agents. 2008; 31 supl 4: 389-91. [ Links ]

8. Giamarellou H, Antoniadou A, Kanellakopoulou K. Acinetobacter baumannii: a universal threat to public health? Int J Antimicrob Agents. 2008; 32: 106-19. [ Links ]

9. Villegas MV, Kattan J, Correa A, Lolans K, Guzman AM, Woodford N, et al. Dissemination of Acinetobacter baumannii Clones with OXA-23 Carbapenemase in Colombian Hospitals. Antimicrob Agents Chemother. 2007; 51:2001-4. [ Links ]

10. Touati M, Diene SM, Racherache A, Dekhil M, Djahoudi A, Rolain JM. Emergence of blaOXA-23 and blaOXA-58 carbapenemase-encoding genes in multidrug-resistant Acinetobacter baumannii isolates from University Hospital of Annaba, Algeria. Int J Antimicrob Agents. 2012; 40: 89-91. [ Links ]

11. Mugnier P, Poirel L, Nordmann P. Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumannii. J Bacteriol. 2009; 191:2414-18. [ Links ]

12. Aubert D, Naas T, Héritier C, Poirel L, Nordmann P. Functional characterization of IS1999, an IS4 family element involved in mobilization and expression of beta-lactam resistance genes. J Bacteriol. 2006; 188; Supl 18:6506-14. [ Links ]

13. Mazel D. Integrons: agents of bacterial evolution. Nat Rev Microbiol. 2006; 4: 608-20. [ Links ]

14. Ramírez MS, Stietz MS, Vilacoba E, Jeric P, Limansky AS, Catalano M, et al. Increasing frequency of class 1 and 2 integrons in multidrug-resistant clones of Acinetobacter baumannii reveals the need for continuous molecular surveillance. Int J Antimicrob Agents. 2011; 37:175-77. [ Links ]

15. Ramirez MS, Pineiro S, Centron D. Novel insights about class 2 integrons from experimental and genomic epidemiology. Antimicrob Agents Chemother. 2010; 54:699-706. [ Links ]

16. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing: Twenty-third Informational Supplement; 2013. M100-S23. CLSI, Wayne, PA, USA. [ Links ]

17. Manchanda V, Sanchaita S, Singh NP. Multidrug Resistant Acinetobacter. J Glob Infect Dis. 2010; 2 Supl 3: 291-304. [ Links ]

18. Vaneechoutte M, Dijishoorn L, Tjernberg I, Elaichouni A, de Vos P, Claeys G, Verschraegen G. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J Clin Microbiol. 1995; 33:11-15.). [ Links ]

19. Dijkshoorn L, Van Harsselaar B, Tjernberg I, Bouvet PJ, Vaneechoutte M. Evaluation of amplified ribosomal DNA restriction analysis for identification of Acinetobacter genomic species. Syst Appl Microbiol. 1998; 21:33-39. [ Links ]

20. Kimura MA. Simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J Mol Evol. 1980;16:111-20. [ Links ]

21. Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol. 2011; 28: 2731-39. [ Links ]

22. Vaneechoutte M, Dijkshoorn L, Tjernberg I, Elaichouni A, de Vos P, Claeys G, Verschraegen G. Identification of Acinetobacter genomic species by amplified ribosomal DNA restriction analysis. J Clin Microbiol. 1995; 33 (Supl 1):11-15. [ Links ]

23. Sundsfjord A, Simonsen GS, Haldorsen BC, Haaheim SO, Hjelmevoll SO, Littauer P, Dahl KH. Genetic methods for detection of antimicrobial resistance. APMIS. 2004; 112: 815-37. [ Links ]

24. Queenan AM, Bush K. Carbapenemases: the versatile beta-lactamases. Clin Microbiol Rev. 2007; 20: 440-58. [ Links ]

25. Walsh TR, Toleman MA, Hryniewicz W, Bennett PM, Jones RN. Evolution of an integron carrying blaVIM-2 in Eastern Europe: report from the SENTRY Antimicrobial Surveillance Program. J Antimicrob Chemother. 2003; 52:116-9. [ Links ]

26. Cantón R, Oliver A, Coque TM, Varela M del C, Pérez-Díaz JC, Baquero F. Epidemiology of extended-spectrum beta-lactamase-producing Enterobacter isolates in a spanish hospital during a 12-year period. J Clin Microbiol. 2002; 40 Supl 4:1237-43. [ Links ]

27. Chuang YC, Chang SC, Wang WK. High and Increasing Oxa-51 DNA Load Predict Mortality in Acinetobacter baumannii Bacteremia: Implication for Pathogenesis and Evaluation of Therapy. Horsburgh MJ, ed. PLoS One. 2010; 5 Supl 11: e14133. [ Links ]

28. Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL. Identification of Acinetobacter baumannii by Detection of the blaOXA-51-like Carbapenemase Gene Intrinsic to This Species. J Clin Microbiol. 2006; 44 Suppl 8:2974-76. [ Links ]

29. Koeleman JG, Stoof J, Van Der Bijl MW, Vandenbroucke Grauls CM, Savelkoul PH. Identification of epidemic strains of Acinetobacter baumannii by integrase gene PCR. J Clin Microbiol. 2001; 39:8-13. [ Links ]

30. Gu B, Tong M, Zhao W, Liu G, Ning M, Pan S, Zhao W. Prevalence and Characterization of Class I Integrons among Pseudomonas aeruginosa and Acinetobacter baumannii Isolates from Patients in Nanjing, China. J Clin Microbiol. 2007; 45 Supl 1:241-43. [ Links ]

31. Falagas ME, Kolets PK, Bliziotis IA. The diversity of definitions of multidrug-resistant and pandrug-resistant (PDR) Acinetobacter baumannii and Pseudomonas aeruginosa. J Med Microbiol. 2006; 55:1619 -29. [ Links ]

32. La Scola B, Bui LTM, Baranton G, Khamis A, Raoult D. Partial rpoB gene sequencing for identification of Leptospira species. FEMS Microbiol Lett. 2006; 263(2): 142-47. [ Links ]

33. Higgins PG, Dammhayn C, Hackel M, Seifert H. Global spread of carbapenem-resistant Acinetobacter baumannii. J Antimicrob Chemother. 2010; 65: 233-8. [ Links ]

34. Montero JC, Ortiz E, Fernandez T, Cayuela A, Marque J, García A, et al. Acinetobacter baumannii ventilator-associated pneumonia: epidemiological and clinical findings. Intensive Care Med. 2005; 31:649-55. [ Links ]

35. Garnacho J, Ortiz C, Fernández E, Aldabo T, Cayuela A, et al. Acinetobacter baumanni ventilator- associated pneumonia: Epidemiological and clinical findings. Intensive Care Med. 2005; 31:649-55. [ Links ]

36. Cortes JA, Leal AL, Montañez AM, Buitrago G, Castillo JS, Guzman L. Frequency of microorganisms isolated in patients with bacteremia in intensive care units in Colombia and their resistance profiles. Braz j infect dis. 2013; 17 Supl 3:346-52 [ Links ]

37. Pinzón JO, Mantilla JR, Valenzuela EM, Fernández F, Álvarez CA, Osorio E. Molecular characterization of Acinetobacter baumannii isolations from a burns unit in a third level attention hospital in Bogotá. Infectio. 2006; 10:71-8. [ Links ]

38. Martínez P, Mattar S. Imipenem-resistant Acinetobacter baumannii carrying the IsaBA1-BlaOXA-23, 51 and IsaB1-BlaaDC-7 genes in Monteria, Colombia. Braz J Microbiol. 2012; 43(4):1274-80. [ Links ]

39. Organización Panamericana de Salud. Informe anual de la Red de Monitoreo de Vigilancia de la Resistencia a los Antibióticos. OPS/HDM/CD/A/541/09 2009. Washington, D.C. Organización Panamericana de la Salud; 2011. [ Links ]

40. Curcio D. Multidrug-resistant gram-negative bacterial infections: Are you ready for the challenge? Curr Clin Pharmacol. 2014; 9: 27-38. [ Links ]

41. Boo TW, Walsh F, Crowley B. Molecular characterization of carbapenem-resistant Acinetobacter species in an Irish university hospital: predominance of Acinetobacter genomic species. J Med Microbiol. 2009; 58 Supl 2: 209-16. [ Links ]

42. Gales AC, Castanheira M, Jones RN, Sader HS. Antimicrobial resistance among Gram-negative bacilli isolated from Latin America: results from SENTRY Antimicrobial Surveillance Program (Latin America, 2008-2010). Diagn Microbiol Infect Dis. 2012; 73:354-60. [ Links ]

43. Dijkshoorn L, Nemec A, Seifert H. An increasing threat in hospitals: multidrug-resistant Acinetobacter baumannii. Nat Rev Microbiol. 2007; 5:939-951. [ Links ]

44. Karageorgopoulos DE, Kelesidis T, Kelesidis I, Falagas ME. Tigecycline for the treatment of multidrug-resistant (including carbapenem-resistant) Acinetobacter infections: a review of the scientific evidence. J Antimicrob Chemother. 2008; 62 Supl 1: 45-55. [ Links ]

45. Poirel L, Nordmann P. Genetic structures at the origin of acquisition and expression of the carbapenem-hydrolyzing oxacillinase gene blaOXA-58 in Acinetobacter baumannii. Antimicrob Agents Chemother. 2006; 50: 1442-48. [ Links ]

46. Hrenovica J, Durnb G, Goic-Barisicc I, Kovacicd A. Occurrence of an Environmental Acinetobacter baumannii Strain Similar to a Clinical Isolate in Paleosol from Croatia. Appl Environ Microbiol. 2014; 80:2860-66. [ Links ]

47. Poirel L, Nordmann P. Carbapenem resistance in Acinetobacter baumannii: mechanisms and epidemiology. Clin Microbiol Infect. 2006; 12:826- 36. [ Links ]

Recibido: 14 de Enero de 2017; Revisado: 28 de Marzo de 2017; Aprobado: 29 de Septiembre de 2017

Conflictos de interés: Los autores declaran no tener conflictos de intereses

Creative Commons License This is an open-access article distributed under the terms of the Creative Commons Attribution License